ID: 1029618257

View in Genome Browser
Species Human (GRCh38)
Location 7:101673632-101673654
Sequence TGGGTATACCTCCAGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029618257_1029618270 7 Left 1029618257 7:101673632-101673654 CCTGCCCACTGGAGGTATACCCA No data
Right 1029618270 7:101673662-101673684 CCCCTATGTATTCAAGGGGAGGG No data
1029618257_1029618264 1 Left 1029618257 7:101673632-101673654 CCTGCCCACTGGAGGTATACCCA No data
Right 1029618264 7:101673656-101673678 GGCCAGCCCCTATGTATTCAAGG No data
1029618257_1029618267 3 Left 1029618257 7:101673632-101673654 CCTGCCCACTGGAGGTATACCCA No data
Right 1029618267 7:101673658-101673680 CCAGCCCCTATGTATTCAAGGGG No data
1029618257_1029618268 6 Left 1029618257 7:101673632-101673654 CCTGCCCACTGGAGGTATACCCA No data
Right 1029618268 7:101673661-101673683 GCCCCTATGTATTCAAGGGGAGG No data
1029618257_1029618265 2 Left 1029618257 7:101673632-101673654 CCTGCCCACTGGAGGTATACCCA No data
Right 1029618265 7:101673657-101673679 GCCAGCCCCTATGTATTCAAGGG No data
1029618257_1029618272 8 Left 1029618257 7:101673632-101673654 CCTGCCCACTGGAGGTATACCCA No data
Right 1029618272 7:101673663-101673685 CCCTATGTATTCAAGGGGAGGGG No data
1029618257_1029618274 19 Left 1029618257 7:101673632-101673654 CCTGCCCACTGGAGGTATACCCA No data
Right 1029618274 7:101673674-101673696 CAAGGGGAGGGGATTATATAAGG No data
1029618257_1029618275 20 Left 1029618257 7:101673632-101673654 CCTGCCCACTGGAGGTATACCCA No data
Right 1029618275 7:101673675-101673697 AAGGGGAGGGGATTATATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029618257 Original CRISPR TGGGTATACCTCCAGTGGGC AGG (reversed) Intergenic
No off target data available for this crispr