ID: 1029626188

View in Genome Browser
Species Human (GRCh38)
Location 7:101721717-101721739
Sequence CCACCGTGCCTGGCACAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029626188_1029626192 5 Left 1029626188 7:101721717-101721739 CCGGTTTGTGCCAGGCACGGTGG No data
Right 1029626192 7:101721745-101721767 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
1029626188_1029626196 14 Left 1029626188 7:101721717-101721739 CCGGTTTGTGCCAGGCACGGTGG No data
Right 1029626196 7:101721754-101721776 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
1029626188_1029626191 4 Left 1029626188 7:101721717-101721739 CCGGTTTGTGCCAGGCACGGTGG No data
Right 1029626191 7:101721744-101721766 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
1029626188_1029626194 8 Left 1029626188 7:101721717-101721739 CCGGTTTGTGCCAGGCACGGTGG No data
Right 1029626194 7:101721748-101721770 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1029626188_1029626199 21 Left 1029626188 7:101721717-101721739 CCGGTTTGTGCCAGGCACGGTGG No data
Right 1029626199 7:101721761-101721783 CTTTGGGAGGCCAAGGCAGGTGG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
1029626188_1029626198 18 Left 1029626188 7:101721717-101721739 CCGGTTTGTGCCAGGCACGGTGG No data
Right 1029626198 7:101721758-101721780 GCACTTTGGGAGGCCAAGGCAGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029626188 Original CRISPR CCACCGTGCCTGGCACAAAC CGG (reversed) Intergenic
No off target data available for this crispr