ID: 1029626962

View in Genome Browser
Species Human (GRCh38)
Location 7:101725922-101725944
Sequence TTCCCTCGGAGGGGCCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029626962_1029626969 4 Left 1029626962 7:101725922-101725944 CCCAAGGGGCCCCTCCGAGGGAA No data
Right 1029626969 7:101725949-101725971 GCAGCTCCAACCCACCAGCTTGG No data
1029626962_1029626974 26 Left 1029626962 7:101725922-101725944 CCCAAGGGGCCCCTCCGAGGGAA No data
Right 1029626974 7:101725971-101725993 GCTGCCATCGTCAGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029626962 Original CRISPR TTCCCTCGGAGGGGCCCCTT GGG (reversed) Intergenic
No off target data available for this crispr