ID: 1029626969

View in Genome Browser
Species Human (GRCh38)
Location 7:101725949-101725971
Sequence GCAGCTCCAACCCACCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029626966_1029626969 -6 Left 1029626966 7:101725932-101725954 CCCTCCGAGGGAATCTGGCAGCT No data
Right 1029626969 7:101725949-101725971 GCAGCTCCAACCCACCAGCTTGG No data
1029626967_1029626969 -7 Left 1029626967 7:101725933-101725955 CCTCCGAGGGAATCTGGCAGCTC No data
Right 1029626969 7:101725949-101725971 GCAGCTCCAACCCACCAGCTTGG No data
1029626963_1029626969 3 Left 1029626963 7:101725923-101725945 CCAAGGGGCCCCTCCGAGGGAAT No data
Right 1029626969 7:101725949-101725971 GCAGCTCCAACCCACCAGCTTGG No data
1029626962_1029626969 4 Left 1029626962 7:101725922-101725944 CCCAAGGGGCCCCTCCGAGGGAA No data
Right 1029626969 7:101725949-101725971 GCAGCTCCAACCCACCAGCTTGG No data
1029626965_1029626969 -5 Left 1029626965 7:101725931-101725953 CCCCTCCGAGGGAATCTGGCAGC No data
Right 1029626969 7:101725949-101725971 GCAGCTCCAACCCACCAGCTTGG No data
1029626968_1029626969 -10 Left 1029626968 7:101725936-101725958 CCGAGGGAATCTGGCAGCTCCAA No data
Right 1029626969 7:101725949-101725971 GCAGCTCCAACCCACCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029626969 Original CRISPR GCAGCTCCAACCCACCAGCT TGG Intergenic
No off target data available for this crispr