ID: 1029626974

View in Genome Browser
Species Human (GRCh38)
Location 7:101725971-101725993
Sequence GCTGCCATCGTCAGCAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029626967_1029626974 15 Left 1029626967 7:101725933-101725955 CCTCCGAGGGAATCTGGCAGCTC No data
Right 1029626974 7:101725971-101725993 GCTGCCATCGTCAGCAGAAGAGG No data
1029626970_1029626974 -7 Left 1029626970 7:101725955-101725977 CCAACCCACCAGCTTGGCTGCCA No data
Right 1029626974 7:101725971-101725993 GCTGCCATCGTCAGCAGAAGAGG No data
1029626962_1029626974 26 Left 1029626962 7:101725922-101725944 CCCAAGGGGCCCCTCCGAGGGAA No data
Right 1029626974 7:101725971-101725993 GCTGCCATCGTCAGCAGAAGAGG No data
1029626965_1029626974 17 Left 1029626965 7:101725931-101725953 CCCCTCCGAGGGAATCTGGCAGC No data
Right 1029626974 7:101725971-101725993 GCTGCCATCGTCAGCAGAAGAGG No data
1029626963_1029626974 25 Left 1029626963 7:101725923-101725945 CCAAGGGGCCCCTCCGAGGGAAT No data
Right 1029626974 7:101725971-101725993 GCTGCCATCGTCAGCAGAAGAGG No data
1029626966_1029626974 16 Left 1029626966 7:101725932-101725954 CCCTCCGAGGGAATCTGGCAGCT No data
Right 1029626974 7:101725971-101725993 GCTGCCATCGTCAGCAGAAGAGG No data
1029626968_1029626974 12 Left 1029626968 7:101725936-101725958 CCGAGGGAATCTGGCAGCTCCAA No data
Right 1029626974 7:101725971-101725993 GCTGCCATCGTCAGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029626974 Original CRISPR GCTGCCATCGTCAGCAGAAG AGG Intergenic
No off target data available for this crispr