ID: 1029629609

View in Genome Browser
Species Human (GRCh38)
Location 7:101742346-101742368
Sequence AGAAAAGGGGAGGGGGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629609_1029629631 25 Left 1029629609 7:101742346-101742368 CCACAGCCCCCCTCCCCTTTTCT No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629609_1029629618 -3 Left 1029629609 7:101742346-101742368 CCACAGCCCCCCTCCCCTTTTCT No data
Right 1029629618 7:101742366-101742388 TCTAACTCCAAAAAGCCCAGAGG No data
1029629609_1029629628 23 Left 1029629609 7:101742346-101742368 CCACAGCCCCCCTCCCCTTTTCT No data
Right 1029629628 7:101742392-101742414 AGCCGTGTTTGGAGAAGGAGGGG No data
1029629609_1029629626 21 Left 1029629609 7:101742346-101742368 CCACAGCCCCCCTCCCCTTTTCT No data
Right 1029629626 7:101742390-101742412 CCAGCCGTGTTTGGAGAAGGAGG No data
1029629609_1029629627 22 Left 1029629609 7:101742346-101742368 CCACAGCCCCCCTCCCCTTTTCT No data
Right 1029629627 7:101742391-101742413 CAGCCGTGTTTGGAGAAGGAGGG No data
1029629609_1029629629 24 Left 1029629609 7:101742346-101742368 CCACAGCCCCCCTCCCCTTTTCT No data
Right 1029629629 7:101742393-101742415 GCCGTGTTTGGAGAAGGAGGGGG No data
1029629609_1029629621 12 Left 1029629609 7:101742346-101742368 CCACAGCCCCCCTCCCCTTTTCT No data
Right 1029629621 7:101742381-101742403 CCCAGAGGCCCAGCCGTGTTTGG No data
1029629609_1029629623 18 Left 1029629609 7:101742346-101742368 CCACAGCCCCCCTCCCCTTTTCT No data
Right 1029629623 7:101742387-101742409 GGCCCAGCCGTGTTTGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629609 Original CRISPR AGAAAAGGGGAGGGGGGCTG TGG (reversed) Intergenic
No off target data available for this crispr