ID: 1029629612

View in Genome Browser
Species Human (GRCh38)
Location 7:101742354-101742376
Sequence TTGGAGTTAGAAAAGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629612_1029629629 16 Left 1029629612 7:101742354-101742376 CCCCTCCCCTTTTCTAACTCCAA No data
Right 1029629629 7:101742393-101742415 GCCGTGTTTGGAGAAGGAGGGGG No data
1029629612_1029629631 17 Left 1029629612 7:101742354-101742376 CCCCTCCCCTTTTCTAACTCCAA No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629612_1029629623 10 Left 1029629612 7:101742354-101742376 CCCCTCCCCTTTTCTAACTCCAA No data
Right 1029629623 7:101742387-101742409 GGCCCAGCCGTGTTTGGAGAAGG No data
1029629612_1029629628 15 Left 1029629612 7:101742354-101742376 CCCCTCCCCTTTTCTAACTCCAA No data
Right 1029629628 7:101742392-101742414 AGCCGTGTTTGGAGAAGGAGGGG No data
1029629612_1029629632 30 Left 1029629612 7:101742354-101742376 CCCCTCCCCTTTTCTAACTCCAA No data
Right 1029629632 7:101742407-101742429 AGGAGGGGGGCCCTGAAGCTTGG No data
1029629612_1029629626 13 Left 1029629612 7:101742354-101742376 CCCCTCCCCTTTTCTAACTCCAA No data
Right 1029629626 7:101742390-101742412 CCAGCCGTGTTTGGAGAAGGAGG No data
1029629612_1029629621 4 Left 1029629612 7:101742354-101742376 CCCCTCCCCTTTTCTAACTCCAA No data
Right 1029629621 7:101742381-101742403 CCCAGAGGCCCAGCCGTGTTTGG No data
1029629612_1029629627 14 Left 1029629612 7:101742354-101742376 CCCCTCCCCTTTTCTAACTCCAA No data
Right 1029629627 7:101742391-101742413 CAGCCGTGTTTGGAGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629612 Original CRISPR TTGGAGTTAGAAAAGGGGAG GGG (reversed) Intergenic
No off target data available for this crispr