ID: 1029629619

View in Genome Browser
Species Human (GRCh38)
Location 7:101742373-101742395
Sequence GGCTGGGCCTCTGGGCTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629619_1029629631 -2 Left 1029629619 7:101742373-101742395 CCAAAAAGCCCAGAGGCCCAGCC No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629619_1029629627 -5 Left 1029629619 7:101742373-101742395 CCAAAAAGCCCAGAGGCCCAGCC No data
Right 1029629627 7:101742391-101742413 CAGCCGTGTTTGGAGAAGGAGGG No data
1029629619_1029629633 12 Left 1029629619 7:101742373-101742395 CCAAAAAGCCCAGAGGCCCAGCC No data
Right 1029629633 7:101742408-101742430 GGAGGGGGGCCCTGAAGCTTGGG No data
1029629619_1029629632 11 Left 1029629619 7:101742373-101742395 CCAAAAAGCCCAGAGGCCCAGCC No data
Right 1029629632 7:101742407-101742429 AGGAGGGGGGCCCTGAAGCTTGG No data
1029629619_1029629629 -3 Left 1029629619 7:101742373-101742395 CCAAAAAGCCCAGAGGCCCAGCC No data
Right 1029629629 7:101742393-101742415 GCCGTGTTTGGAGAAGGAGGGGG No data
1029629619_1029629626 -6 Left 1029629619 7:101742373-101742395 CCAAAAAGCCCAGAGGCCCAGCC No data
Right 1029629626 7:101742390-101742412 CCAGCCGTGTTTGGAGAAGGAGG No data
1029629619_1029629628 -4 Left 1029629619 7:101742373-101742395 CCAAAAAGCCCAGAGGCCCAGCC No data
Right 1029629628 7:101742392-101742414 AGCCGTGTTTGGAGAAGGAGGGG No data
1029629619_1029629623 -9 Left 1029629619 7:101742373-101742395 CCAAAAAGCCCAGAGGCCCAGCC No data
Right 1029629623 7:101742387-101742409 GGCCCAGCCGTGTTTGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629619 Original CRISPR GGCTGGGCCTCTGGGCTTTT TGG (reversed) Intergenic
No off target data available for this crispr