ID: 1029629620

View in Genome Browser
Species Human (GRCh38)
Location 7:101742381-101742403
Sequence CCAAACACGGCTGGGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629620_1029629631 -10 Left 1029629620 7:101742381-101742403 CCCAGAGGCCCAGCCGTGTTTGG No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629620_1029629640 30 Left 1029629620 7:101742381-101742403 CCCAGAGGCCCAGCCGTGTTTGG No data
Right 1029629640 7:101742434-101742456 CCTTCAAAGTGACTGCAGGGAGG No data
1029629620_1029629633 4 Left 1029629620 7:101742381-101742403 CCCAGAGGCCCAGCCGTGTTTGG No data
Right 1029629633 7:101742408-101742430 GGAGGGGGGCCCTGAAGCTTGGG No data
1029629620_1029629636 26 Left 1029629620 7:101742381-101742403 CCCAGAGGCCCAGCCGTGTTTGG No data
Right 1029629636 7:101742430-101742452 GCCACCTTCAAAGTGACTGCAGG No data
1029629620_1029629638 27 Left 1029629620 7:101742381-101742403 CCCAGAGGCCCAGCCGTGTTTGG No data
Right 1029629638 7:101742431-101742453 CCACCTTCAAAGTGACTGCAGGG No data
1029629620_1029629632 3 Left 1029629620 7:101742381-101742403 CCCAGAGGCCCAGCCGTGTTTGG No data
Right 1029629632 7:101742407-101742429 AGGAGGGGGGCCCTGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629620 Original CRISPR CCAAACACGGCTGGGCCTCT GGG (reversed) Intergenic
No off target data available for this crispr