ID: 1029629631

View in Genome Browser
Species Human (GRCh38)
Location 7:101742394-101742416
Sequence CCGTGTTTGGAGAAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629615_1029629631 12 Left 1029629615 7:101742359-101742381 CCCCTTTTCTAACTCCAAAAAGC No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629617_1029629631 10 Left 1029629617 7:101742361-101742383 CCTTTTCTAACTCCAAAAAGCCC No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629611_1029629631 18 Left 1029629611 7:101742353-101742375 CCCCCTCCCCTTTTCTAACTCCA No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629619_1029629631 -2 Left 1029629619 7:101742373-101742395 CCAAAAAGCCCAGAGGCCCAGCC No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629613_1029629631 16 Left 1029629613 7:101742355-101742377 CCCTCCCCTTTTCTAACTCCAAA No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629610_1029629631 19 Left 1029629610 7:101742352-101742374 CCCCCCTCCCCTTTTCTAACTCC No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629608_1029629631 26 Left 1029629608 7:101742345-101742367 CCCACAGCCCCCCTCCCCTTTTC No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629612_1029629631 17 Left 1029629612 7:101742354-101742376 CCCCTCCCCTTTTCTAACTCCAA No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629620_1029629631 -10 Left 1029629620 7:101742381-101742403 CCCAGAGGCCCAGCCGTGTTTGG No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629616_1029629631 11 Left 1029629616 7:101742360-101742382 CCCTTTTCTAACTCCAAAAAGCC No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629614_1029629631 15 Left 1029629614 7:101742356-101742378 CCTCCCCTTTTCTAACTCCAAAA No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629609_1029629631 25 Left 1029629609 7:101742346-101742368 CCACAGCCCCCCTCCCCTTTTCT No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data
1029629607_1029629631 27 Left 1029629607 7:101742344-101742366 CCCCACAGCCCCCCTCCCCTTTT No data
Right 1029629631 7:101742394-101742416 CCGTGTTTGGAGAAGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629631 Original CRISPR CCGTGTTTGGAGAAGGAGGG GGG Intergenic
No off target data available for this crispr