ID: 1029629911 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:101743805-101743827 |
| Sequence | GGTCGCTCTGGCTCAGCCTC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1029629911_1029629929 | 27 | Left | 1029629911 | 7:101743805-101743827 | CCGGAGGCTGAGCCAGAGCGACC | No data | ||
| Right | 1029629929 | 7:101743855-101743877 | AGGCCTCTCACACCCTCCCCCGG | No data | ||||
| 1029629911_1029629918 | 7 | Left | 1029629911 | 7:101743805-101743827 | CCGGAGGCTGAGCCAGAGCGACC | No data | ||
| Right | 1029629918 | 7:101743835-101743857 | CGCCCCCGCCCCCCTCCATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1029629911 | Original CRISPR | GGTCGCTCTGGCTCAGCCTC CGG (reversed) | Intergenic | ||