ID: 1029629913 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:101743817-101743839 |
| Sequence | GGGCGGATCCGGGGTCGCTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1029629913_1029629918 | -5 | Left | 1029629913 | 7:101743817-101743839 | CCAGAGCGACCCCGGATCCGCCC | No data | ||
| Right | 1029629918 | 7:101743835-101743857 | CGCCCCCGCCCCCCTCCATGAGG | No data | ||||
| 1029629913_1029629931 | 21 | Left | 1029629913 | 7:101743817-101743839 | CCAGAGCGACCCCGGATCCGCCC | No data | ||
| Right | 1029629931 | 7:101743861-101743883 | CTCACACCCTCCCCCGGCCCAGG | No data | ||||
| 1029629913_1029629929 | 15 | Left | 1029629913 | 7:101743817-101743839 | CCAGAGCGACCCCGGATCCGCCC | No data | ||
| Right | 1029629929 | 7:101743855-101743877 | AGGCCTCTCACACCCTCCCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1029629913 | Original CRISPR | GGGCGGATCCGGGGTCGCTC TGG (reversed) | Intergenic | ||