ID: 1029629913

View in Genome Browser
Species Human (GRCh38)
Location 7:101743817-101743839
Sequence GGGCGGATCCGGGGTCGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629913_1029629931 21 Left 1029629913 7:101743817-101743839 CCAGAGCGACCCCGGATCCGCCC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629913_1029629929 15 Left 1029629913 7:101743817-101743839 CCAGAGCGACCCCGGATCCGCCC No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629913_1029629918 -5 Left 1029629913 7:101743817-101743839 CCAGAGCGACCCCGGATCCGCCC No data
Right 1029629918 7:101743835-101743857 CGCCCCCGCCCCCCTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629913 Original CRISPR GGGCGGATCCGGGGTCGCTC TGG (reversed) Intergenic
No off target data available for this crispr