ID: 1029629914

View in Genome Browser
Species Human (GRCh38)
Location 7:101743826-101743848
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629914_1029629929 6 Left 1029629914 7:101743826-101743848 CCCCGGATCCGCCCCCGCCCCCC No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629914_1029629931 12 Left 1029629914 7:101743826-101743848 CCCCGGATCCGCCCCCGCCCCCC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629914 Original CRISPR GGGGGGCGGGGGCGGATCCG GGG (reversed) Intergenic