ID: 1029629915

View in Genome Browser
Species Human (GRCh38)
Location 7:101743827-101743849
Sequence AGGGGGGCGGGGGCGGATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629915_1029629931 11 Left 1029629915 7:101743827-101743849 CCCGGATCCGCCCCCGCCCCCCT No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629915_1029629929 5 Left 1029629915 7:101743827-101743849 CCCGGATCCGCCCCCGCCCCCCT No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629915 Original CRISPR AGGGGGGCGGGGGCGGATCC GGG (reversed) Intergenic
No off target data available for this crispr