ID: 1029629916

View in Genome Browser
Species Human (GRCh38)
Location 7:101743828-101743850
Sequence GAGGGGGGCGGGGGCGGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629916_1029629931 10 Left 1029629916 7:101743828-101743850 CCGGATCCGCCCCCGCCCCCCTC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629916_1029629929 4 Left 1029629916 7:101743828-101743850 CCGGATCCGCCCCCGCCCCCCTC No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629916 Original CRISPR GAGGGGGGCGGGGGCGGATC CGG (reversed) Intergenic
No off target data available for this crispr