ID: 1029629916 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:101743828-101743850 |
Sequence | GAGGGGGGCGGGGGCGGATC CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1029629916_1029629931 | 10 | Left | 1029629916 | 7:101743828-101743850 | CCGGATCCGCCCCCGCCCCCCTC | No data | ||
Right | 1029629931 | 7:101743861-101743883 | CTCACACCCTCCCCCGGCCCAGG | No data | ||||
1029629916_1029629929 | 4 | Left | 1029629916 | 7:101743828-101743850 | CCGGATCCGCCCCCGCCCCCCTC | No data | ||
Right | 1029629929 | 7:101743855-101743877 | AGGCCTCTCACACCCTCCCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1029629916 | Original CRISPR | GAGGGGGGCGGGGGCGGATC CGG (reversed) | Intergenic | ||