ID: 1029629922

View in Genome Browser
Species Human (GRCh38)
Location 7:101743840-101743862
Sequence AGAGGCCTCATGGAGGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629922_1029629929 -8 Left 1029629922 7:101743840-101743862 CCGCCCCCCTCCATGAGGCCTCT No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629922_1029629942 25 Left 1029629922 7:101743840-101743862 CCGCCCCCCTCCATGAGGCCTCT No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629922_1029629931 -2 Left 1029629922 7:101743840-101743862 CCGCCCCCCTCCATGAGGCCTCT No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629922_1029629945 28 Left 1029629922 7:101743840-101743862 CCGCCCCCCTCCATGAGGCCTCT No data
Right 1029629945 7:101743891-101743913 CCCCAAAGCCCACTCTCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629922 Original CRISPR AGAGGCCTCATGGAGGGGGG CGG (reversed) Intergenic
No off target data available for this crispr