ID: 1029629924

View in Genome Browser
Species Human (GRCh38)
Location 7:101743844-101743866
Sequence TGTGAGAGGCCTCATGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629924_1029629931 -6 Left 1029629924 7:101743844-101743866 CCCCCTCCATGAGGCCTCTCACA No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629924_1029629942 21 Left 1029629924 7:101743844-101743866 CCCCCTCCATGAGGCCTCTCACA No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629924_1029629948 30 Left 1029629924 7:101743844-101743866 CCCCCTCCATGAGGCCTCTCACA No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629924_1029629945 24 Left 1029629924 7:101743844-101743866 CCCCCTCCATGAGGCCTCTCACA No data
Right 1029629945 7:101743891-101743913 CCCCAAAGCCCACTCTCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629924 Original CRISPR TGTGAGAGGCCTCATGGAGG GGG (reversed) Intergenic
No off target data available for this crispr