ID: 1029629926

View in Genome Browser
Species Human (GRCh38)
Location 7:101743846-101743868
Sequence GGTGTGAGAGGCCTCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629926_1029629948 28 Left 1029629926 7:101743846-101743868 CCCTCCATGAGGCCTCTCACACC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629926_1029629942 19 Left 1029629926 7:101743846-101743868 CCCTCCATGAGGCCTCTCACACC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629926_1029629945 22 Left 1029629926 7:101743846-101743868 CCCTCCATGAGGCCTCTCACACC No data
Right 1029629945 7:101743891-101743913 CCCCAAAGCCCACTCTCCGGAGG No data
1029629926_1029629931 -8 Left 1029629926 7:101743846-101743868 CCCTCCATGAGGCCTCTCACACC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629926 Original CRISPR GGTGTGAGAGGCCTCATGGA GGG (reversed) Intergenic