ID: 1029629929

View in Genome Browser
Species Human (GRCh38)
Location 7:101743855-101743877
Sequence AGGCCTCTCACACCCTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629920_1029629929 -6 Left 1029629920 7:101743838-101743860 CCCCGCCCCCCTCCATGAGGCCT No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629914_1029629929 6 Left 1029629914 7:101743826-101743848 CCCCGGATCCGCCCCCGCCCCCC No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629913_1029629929 15 Left 1029629913 7:101743817-101743839 CCAGAGCGACCCCGGATCCGCCC No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629917_1029629929 -2 Left 1029629917 7:101743834-101743856 CCGCCCCCGCCCCCCTCCATGAG No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629921_1029629929 -7 Left 1029629921 7:101743839-101743861 CCCGCCCCCCTCCATGAGGCCTC No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629922_1029629929 -8 Left 1029629922 7:101743840-101743862 CCGCCCCCCTCCATGAGGCCTCT No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629909_1029629929 29 Left 1029629909 7:101743803-101743825 CCCCGGAGGCTGAGCCAGAGCGA No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629919_1029629929 -5 Left 1029629919 7:101743837-101743859 CCCCCGCCCCCCTCCATGAGGCC No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629915_1029629929 5 Left 1029629915 7:101743827-101743849 CCCGGATCCGCCCCCGCCCCCCT No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629910_1029629929 28 Left 1029629910 7:101743804-101743826 CCCGGAGGCTGAGCCAGAGCGAC No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629911_1029629929 27 Left 1029629911 7:101743805-101743827 CCGGAGGCTGAGCCAGAGCGACC No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data
1029629916_1029629929 4 Left 1029629916 7:101743828-101743850 CCGGATCCGCCCCCGCCCCCCTC No data
Right 1029629929 7:101743855-101743877 AGGCCTCTCACACCCTCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629929 Original CRISPR AGGCCTCTCACACCCTCCCC CGG Intergenic
No off target data available for this crispr