ID: 1029629931

View in Genome Browser
Species Human (GRCh38)
Location 7:101743861-101743883
Sequence CTCACACCCTCCCCCGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629924_1029629931 -6 Left 1029629924 7:101743844-101743866 CCCCCTCCATGAGGCCTCTCACA No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629927_1029629931 -9 Left 1029629927 7:101743847-101743869 CCTCCATGAGGCCTCTCACACCC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629925_1029629931 -7 Left 1029629925 7:101743845-101743867 CCCCTCCATGAGGCCTCTCACAC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629919_1029629931 1 Left 1029629919 7:101743837-101743859 CCCCCGCCCCCCTCCATGAGGCC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629913_1029629931 21 Left 1029629913 7:101743817-101743839 CCAGAGCGACCCCGGATCCGCCC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629917_1029629931 4 Left 1029629917 7:101743834-101743856 CCGCCCCCGCCCCCCTCCATGAG No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629915_1029629931 11 Left 1029629915 7:101743827-101743849 CCCGGATCCGCCCCCGCCCCCCT No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629916_1029629931 10 Left 1029629916 7:101743828-101743850 CCGGATCCGCCCCCGCCCCCCTC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629923_1029629931 -5 Left 1029629923 7:101743843-101743865 CCCCCCTCCATGAGGCCTCTCAC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629921_1029629931 -1 Left 1029629921 7:101743839-101743861 CCCGCCCCCCTCCATGAGGCCTC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629914_1029629931 12 Left 1029629914 7:101743826-101743848 CCCCGGATCCGCCCCCGCCCCCC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629920_1029629931 0 Left 1029629920 7:101743838-101743860 CCCCGCCCCCCTCCATGAGGCCT No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629922_1029629931 -2 Left 1029629922 7:101743840-101743862 CCGCCCCCCTCCATGAGGCCTCT No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data
1029629926_1029629931 -8 Left 1029629926 7:101743846-101743868 CCCTCCATGAGGCCTCTCACACC No data
Right 1029629931 7:101743861-101743883 CTCACACCCTCCCCCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629931 Original CRISPR CTCACACCCTCCCCCGGCCC AGG Intergenic
No off target data available for this crispr