ID: 1029629942

View in Genome Browser
Species Human (GRCh38)
Location 7:101743888-101743910
Sequence CTCCCCCAAAGCCCACTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629927_1029629942 18 Left 1029629927 7:101743847-101743869 CCTCCATGAGGCCTCTCACACCC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629922_1029629942 25 Left 1029629922 7:101743840-101743862 CCGCCCCCCTCCATGAGGCCTCT No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629930_1029629942 7 Left 1029629930 7:101743858-101743880 CCTCTCACACCCTCCCCCGGCCC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629928_1029629942 15 Left 1029629928 7:101743850-101743872 CCATGAGGCCTCTCACACCCTCC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629920_1029629942 27 Left 1029629920 7:101743838-101743860 CCCCGCCCCCCTCCATGAGGCCT No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629935_1029629942 -7 Left 1029629935 7:101743872-101743894 CCCCGGCCCAGGCCACCTCCCCC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629919_1029629942 28 Left 1029629919 7:101743837-101743859 CCCCCGCCCCCCTCCATGAGGCC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629923_1029629942 22 Left 1029629923 7:101743843-101743865 CCCCCCTCCATGAGGCCTCTCAC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629924_1029629942 21 Left 1029629924 7:101743844-101743866 CCCCCTCCATGAGGCCTCTCACA No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629933_1029629942 -3 Left 1029629933 7:101743868-101743890 CCTCCCCCGGCCCAGGCCACCTC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629932_1029629942 -2 Left 1029629932 7:101743867-101743889 CCCTCCCCCGGCCCAGGCCACCT No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629936_1029629942 -8 Left 1029629936 7:101743873-101743895 CCCGGCCCAGGCCACCTCCCCCA No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629934_1029629942 -6 Left 1029629934 7:101743871-101743893 CCCCCGGCCCAGGCCACCTCCCC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629926_1029629942 19 Left 1029629926 7:101743846-101743868 CCCTCCATGAGGCCTCTCACACC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629925_1029629942 20 Left 1029629925 7:101743845-101743867 CCCCTCCATGAGGCCTCTCACAC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629937_1029629942 -9 Left 1029629937 7:101743874-101743896 CCGGCCCAGGCCACCTCCCCCAA No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data
1029629921_1029629942 26 Left 1029629921 7:101743839-101743861 CCCGCCCCCCTCCATGAGGCCTC No data
Right 1029629942 7:101743888-101743910 CTCCCCCAAAGCCCACTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629942 Original CRISPR CTCCCCCAAAGCCCACTCTC CGG Intergenic
No off target data available for this crispr