ID: 1029629948

View in Genome Browser
Species Human (GRCh38)
Location 7:101743897-101743919
Sequence AGCCCACTCTCCGGAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029629940_1029629948 -10 Left 1029629940 7:101743884-101743906 CCACCTCCCCCAAAGCCCACTCT No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629932_1029629948 7 Left 1029629932 7:101743867-101743889 CCCTCCCCCGGCCCAGGCCACCT No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629937_1029629948 0 Left 1029629937 7:101743874-101743896 CCGGCCCAGGCCACCTCCCCCAA No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629936_1029629948 1 Left 1029629936 7:101743873-101743895 CCCGGCCCAGGCCACCTCCCCCA No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629934_1029629948 3 Left 1029629934 7:101743871-101743893 CCCCCGGCCCAGGCCACCTCCCC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629928_1029629948 24 Left 1029629928 7:101743850-101743872 CCATGAGGCCTCTCACACCCTCC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629938_1029629948 -4 Left 1029629938 7:101743878-101743900 CCCAGGCCACCTCCCCCAAAGCC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629933_1029629948 6 Left 1029629933 7:101743868-101743890 CCTCCCCCGGCCCAGGCCACCTC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629935_1029629948 2 Left 1029629935 7:101743872-101743894 CCCCGGCCCAGGCCACCTCCCCC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629927_1029629948 27 Left 1029629927 7:101743847-101743869 CCTCCATGAGGCCTCTCACACCC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629930_1029629948 16 Left 1029629930 7:101743858-101743880 CCTCTCACACCCTCCCCCGGCCC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629924_1029629948 30 Left 1029629924 7:101743844-101743866 CCCCCTCCATGAGGCCTCTCACA No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629926_1029629948 28 Left 1029629926 7:101743846-101743868 CCCTCCATGAGGCCTCTCACACC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629925_1029629948 29 Left 1029629925 7:101743845-101743867 CCCCTCCATGAGGCCTCTCACAC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data
1029629939_1029629948 -5 Left 1029629939 7:101743879-101743901 CCAGGCCACCTCCCCCAAAGCCC No data
Right 1029629948 7:101743897-101743919 AGCCCACTCTCCGGAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029629948 Original CRISPR AGCCCACTCTCCGGAGGCCA AGG Intergenic
No off target data available for this crispr