ID: 1029639801

View in Genome Browser
Species Human (GRCh38)
Location 7:101814051-101814073
Sequence CCCTGGCATGTCTATTTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029639801_1029639821 29 Left 1029639801 7:101814051-101814073 CCGCAGAAATAGACATGCCAGGG No data
Right 1029639821 7:101814103-101814125 CGCCGCCTCCCCGAGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029639801 Original CRISPR CCCTGGCATGTCTATTTCTG CGG (reversed) Intergenic
No off target data available for this crispr