ID: 1029640624

View in Genome Browser
Species Human (GRCh38)
Location 7:101817017-101817039
Sequence GGGGTCCGCCACGGAGGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029640624_1029640643 16 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640643 7:101817056-101817078 GGAAACTTGGCGAGGGGCGGCGG 0: 1
1: 0
2: 1
3: 65
4: 730
1029640624_1029640638 3 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640638 7:101817043-101817065 GGGGGCTCTTTGGGGAAACTTGG 0: 1
1: 0
2: 2
3: 22
4: 193
1029640624_1029640641 10 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640641 7:101817050-101817072 CTTTGGGGAAACTTGGCGAGGGG No data
1029640624_1029640645 18 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640645 7:101817058-101817080 AAACTTGGCGAGGGGCGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 105
1029640624_1029640639 8 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640639 7:101817048-101817070 CTCTTTGGGGAAACTTGGCGAGG 0: 1
1: 0
2: 1
3: 11
4: 89
1029640624_1029640646 19 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640646 7:101817059-101817081 AACTTGGCGAGGGGCGGCGGGGG No data
1029640624_1029640633 -5 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640633 7:101817035-101817057 ACCCCCGCGGGGGCTCTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 197
1029640624_1029640640 9 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640640 7:101817049-101817071 TCTTTGGGGAAACTTGGCGAGGG 0: 1
1: 0
2: 0
3: 18
4: 154
1029640624_1029640644 17 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640644 7:101817057-101817079 GAAACTTGGCGAGGGGCGGCGGG No data
1029640624_1029640642 13 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640642 7:101817053-101817075 TGGGGAAACTTGGCGAGGGGCGG 0: 1
1: 0
2: 2
3: 27
4: 267
1029640624_1029640631 -7 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640631 7:101817033-101817055 GGACCCCCGCGGGGGCTCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 69
1029640624_1029640632 -6 Left 1029640624 7:101817017-101817039 CCTGTTCCTCCGTGGCGGACCCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1029640632 7:101817034-101817056 GACCCCCGCGGGGGCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029640624 Original CRISPR GGGGTCCGCCACGGAGGAAC AGG (reversed) Intronic
900119382 1:1041993-1042015 GGGGACGGCCACGGCGGGACAGG - Exonic
900369255 1:2324115-2324137 GGGGAGAGCCACGGAGGAGCAGG - Exonic
901054076 1:6440540-6440562 GGGGCGGGCCACGGAGGTACAGG + Intronic
906148348 1:43573175-43573197 GGGGTAGGCCCAGGAGGAACAGG + Intronic
906395013 1:45455304-45455326 GAAGTCCCCCACAGAGGAACGGG + Intronic
915145822 1:153795262-153795284 TGGGTCAGCAAAGGAGGAACAGG - Intergenic
916663747 1:166947400-166947422 GGGGCTGGCCACGGAGGAAAGGG - Intronic
919801959 1:201359534-201359556 GGGGCCCTCCAAGGAGGAATGGG + Intronic
922802705 1:228371556-228371578 GGAGGCCGCCAGGGAGGAGCAGG + Exonic
1063906598 10:10786143-10786165 GGGGTCAGCCACACAGGAGCTGG + Intergenic
1082000055 11:47389324-47389346 AGGGACAGCCACGGAGGCACAGG - Intergenic
1087071856 11:94089401-94089423 GGGGACCACCAAGGAGGGACAGG + Intronic
1091124482 11:133082741-133082763 GGGGTCCGCAGCGGCGGGACGGG - Intronic
1092060661 12:5547833-5547855 GGGGGCCTCCAGGGAGGAGCTGG + Intronic
1098749278 12:74274685-74274707 GGGGTTCCCCACTGAGGAACTGG - Intergenic
1099679353 12:85805624-85805646 GCTGTCCGCCACAAAGGAACTGG + Exonic
1103527498 12:121578327-121578349 GGGGCCTGCCAGTGAGGAACTGG - Intronic
1105587271 13:21756804-21756826 GAGGACCTCCACGGAGGAATAGG + Intergenic
1111232537 13:85363070-85363092 GGGGGCCCCCACGGAGCAGCAGG - Intergenic
1113189040 13:107722558-107722580 GGGGCCCGCTAGGGAGGCACTGG - Intronic
1118930399 14:70234971-70234993 GGGGCCAGCCACGGAGGAGCTGG - Intergenic
1121514850 14:94542786-94542808 GAGGTCCTCCACGGGGGGACAGG - Intergenic
1121635847 14:95453378-95453400 GGGGTGACCCACGGATGAACAGG + Intronic
1132258695 15:100401725-100401747 GGGGACCTCCACGGGGGAATGGG - Exonic
1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG + Exonic
1142352237 16:89585804-89585826 GGGGTCCTCCAGGGAGGGTCAGG + Intronic
1143572386 17:7767837-7767859 GGCGTCCGTCAGGGAGGAAGAGG + Intronic
1143639970 17:8190150-8190172 GGGGGCCGCAACGGAGGAATTGG + Exonic
1147662264 17:42123033-42123055 CGGCTTCGCCCCGGAGGAACTGG + Exonic
1147675469 17:42202299-42202321 GGGGTCCACAGGGGAGGAACTGG - Intronic
1147690093 17:42309502-42309524 GGGGTCCGCAGGGGAAGAACTGG + Intronic
1148553764 17:48565660-48565682 GGGTTCCCCCACAGAGGAAAGGG - Intronic
1159966268 18:74598374-74598396 GGGGTGCGTCCCGAAGGAACGGG - Intronic
1160567801 18:79798048-79798070 GGGGTCCGCGGCGAAGGAGCCGG + Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162518730 19:11166468-11166490 GGGGTGGGCCAGGGAGGAACGGG + Intronic
1164827734 19:31296809-31296831 GGGGTCAGTCACAAAGGAACAGG + Intronic
1165421453 19:35723974-35723996 GGGGTCCGACGCCGAGGAGCAGG - Exonic
1165992749 19:39825738-39825760 GGGGTACACCACGGAGGCCCAGG + Exonic
926059534 2:9796508-9796530 GGGGTCCTCCAGGCAGGAGCAGG - Intergenic
939889779 2:147722771-147722793 TGGATCCACCACGGATGAACTGG - Intergenic
945196556 2:207242477-207242499 GGGGTCAGCACTGGAGGAACAGG + Intergenic
949019666 2:241734262-241734284 GGGCTCGGCCTCGGAGGAGCGGG + Intergenic
1182068383 22:27446033-27446055 GGGGTCAGCCAAGGAGGCCCTGG + Intergenic
1183462785 22:37962445-37962467 GAGGTCCGCTACTGAGGAATGGG - Intronic
950069640 3:10141970-10141992 AGAGTCCGGCCCGGAGGAACTGG + Exonic
965685287 3:171295814-171295836 AGGGGTGGCCACGGAGGAACAGG - Intronic
966868637 3:184276250-184276272 GGGGTCGGCCGCGGAGGGGCAGG + Intronic
967184056 3:186930575-186930597 GGGGTCCGCTGGGGAAGAACGGG - Exonic
985126373 4:186698752-186698774 CGGCTCCGCCACGGAGAGACTGG + Intronic
985575082 5:670184-670206 GACGTCCGCCCCGGAGGAACAGG - Intronic
985944144 5:3163665-3163687 TGGGTGCCCCATGGAGGAACTGG + Intergenic
991349119 5:65702426-65702448 GGGTTCAGCCATGGAGGTACTGG - Intronic
992548227 5:77836358-77836380 GGGGTCCCCCATGAAGGAATGGG + Intronic
997359876 5:133288326-133288348 GGGGTCCCCCATGGTGGGACAGG + Intronic
1013485273 6:110590560-110590582 GGGGTCAGCCACGAAAGGACAGG + Intergenic
1015244636 6:131062878-131062900 GGGATCCGGCCCGGAGCAACAGG + Intronic
1029640624 7:101817017-101817039 GGGGTCCGCCACGGAGGAACAGG - Intronic
1035448509 7:158959069-158959091 GGAGTCGGCCACAGAGGAAAGGG - Intergenic
1035573207 8:687793-687815 CGGGGCAGCCACGGAGGAATCGG + Intronic
1038237760 8:25777338-25777360 TGGGTCCTCCACGGTGGAAAAGG - Intergenic
1046265616 8:111825530-111825552 GGAGTCCTCCACAGAGGAAAGGG + Intergenic
1049255303 8:141610571-141610593 GGGGTCACCCAAGGAGGAATGGG + Intergenic
1049342091 8:142118618-142118640 GAGATCAGTCACGGAGGAACTGG - Intergenic
1049372131 8:142272961-142272983 GGGGTCCACCAGGGAGTATCAGG - Intronic
1049467019 8:142756185-142756207 GGGGTCACCCAAGGAGGAATGGG - Intergenic
1196950966 X:120875388-120875410 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196951796 X:120931760-120931782 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196952480 X:120936621-120936643 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196953165 X:120941482-120941504 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196953850 X:120946342-120946364 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196954535 X:120951203-120951225 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196955218 X:120956063-120956085 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196955905 X:120960946-120960968 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196956587 X:120965807-120965829 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196957269 X:120970667-120970689 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196957951 X:120975527-120975549 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196958633 X:120980387-120980409 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1196959314 X:120985247-120985269 CGGGCCCGCGACGGAGGAAGAGG - Exonic
1199336048 X:146620079-146620101 GGGCTCCGCCAGGGAGGGAGGGG + Intergenic
1201777805 Y:17685589-17685611 GAGATCAGCCACAGAGGAACTGG + Intergenic
1201823753 Y:18220403-18220425 GAGATCAGCCACAGAGGAACTGG - Intergenic