ID: 1029640636

View in Genome Browser
Species Human (GRCh38)
Location 7:101817038-101817060
Sequence TTTCCCCAAAGAGCCCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029640636_1029640652 28 Left 1029640636 7:101817038-101817060 CCCGCGGGGGCTCTTTGGGGAAA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1029640652 7:101817089-101817111 CGCGCAGTGTCGCTGGGTCCCGG 0: 1
1: 0
2: 0
3: 17
4: 128
1029640636_1029640642 -8 Left 1029640636 7:101817038-101817060 CCCGCGGGGGCTCTTTGGGGAAA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1029640642 7:101817053-101817075 TGGGGAAACTTGGCGAGGGGCGG 0: 1
1: 0
2: 2
3: 27
4: 267
1029640636_1029640646 -2 Left 1029640636 7:101817038-101817060 CCCGCGGGGGCTCTTTGGGGAAA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1029640646 7:101817059-101817081 AACTTGGCGAGGGGCGGCGGGGG No data
1029640636_1029640644 -4 Left 1029640636 7:101817038-101817060 CCCGCGGGGGCTCTTTGGGGAAA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1029640644 7:101817057-101817079 GAAACTTGGCGAGGGGCGGCGGG No data
1029640636_1029640645 -3 Left 1029640636 7:101817038-101817060 CCCGCGGGGGCTCTTTGGGGAAA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1029640645 7:101817058-101817080 AAACTTGGCGAGGGGCGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 105
1029640636_1029640647 21 Left 1029640636 7:101817038-101817060 CCCGCGGGGGCTCTTTGGGGAAA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1029640647 7:101817082-101817104 TGCCCCGCGCGCAGTGTCGCTGG No data
1029640636_1029640643 -5 Left 1029640636 7:101817038-101817060 CCCGCGGGGGCTCTTTGGGGAAA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1029640643 7:101817056-101817078 GGAAACTTGGCGAGGGGCGGCGG 0: 1
1: 0
2: 1
3: 65
4: 730
1029640636_1029640648 22 Left 1029640636 7:101817038-101817060 CCCGCGGGGGCTCTTTGGGGAAA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1029640648 7:101817083-101817105 GCCCCGCGCGCAGTGTCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029640636 Original CRISPR TTTCCCCAAAGAGCCCCCGC GGG (reversed) Intronic
900178684 1:1302081-1302103 TGTCCCGAAAGAGCCCCAGATGG + Intronic
900620151 1:3583062-3583084 TTTCCCCAAGGAGCATCCACAGG - Intronic
906104373 1:43283141-43283163 TTTCTCCAGGGAGCCCCCTCTGG - Intronic
907427192 1:54387406-54387428 TTTCAGCAAAGAGCCCACGTTGG - Intronic
912487942 1:110043821-110043843 TTGCCCCAAAGGGCTCCCGTGGG + Exonic
913118086 1:115714861-115714883 TTCCCCAAAAGAGCCCAAGCTGG - Intronic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
915490552 1:156247921-156247943 TTTCCCAGAAGAGCCCCAGAAGG + Exonic
1063959576 10:11296040-11296062 GTTCACCACAGAGCCCACGCTGG + Intronic
1070570952 10:77638742-77638764 TTTCCCCAAAGAGCCCCCAGTGG + Intergenic
1073065179 10:100754322-100754344 CTTCCCAAAAGAGCACCCTCGGG - Intronic
1077253449 11:1570882-1570904 TCTCCCCTCAGACCCCCCGCTGG + Intronic
1077466504 11:2736111-2736133 TCTGCCCAATGAGCCCCCTCTGG - Intronic
1083226722 11:61290067-61290089 TTTTCCCAAGGAGCCTCCCCTGG + Intronic
1091241453 11:134055119-134055141 TGTCCCCAGAGCTCCCCCGCAGG - Intergenic
1095446372 12:42286964-42286986 TGTCCCCAAAGAGCTGCCGGAGG - Intronic
1096747672 12:53739097-53739119 TCTCCCCAAAGAACCCCGCCTGG - Intergenic
1099286212 12:80716798-80716820 TTTGTCCAGACAGCCCCCGCGGG + Intergenic
1100010982 12:89952625-89952647 CTTCCCCAAAGAGCCCACTTTGG - Intergenic
1103415463 12:120739533-120739555 GGTCCCCAGGGAGCCCCCGCCGG - Exonic
1103479420 12:121241495-121241517 TTTCCCTGAAGAGCCCAGGCTGG + Intronic
1104089001 12:125498878-125498900 TTTCCCCAAAGATAACCCACAGG - Intronic
1106391076 13:29336518-29336540 TGTCCCGAAAGGGCACCCGCCGG + Intronic
1107994402 13:45846679-45846701 TTTTCCCAAATAGTCCCTGCAGG + Intronic
1110058896 13:71015841-71015863 TTTCCCAAAAGAGACTCTGCAGG + Intergenic
1110367914 13:74708540-74708562 TGTCCCCATAGAGCCTCTGCAGG + Intergenic
1113817415 13:113183127-113183149 TGTCCCCAAAAAGCCAGCGCTGG - Intronic
1121315952 14:92961148-92961170 CTTCCCCAGAGAGCCCACTCCGG + Intronic
1123469699 15:20541109-20541131 TGACCCCAAAGAGCCCCGGGAGG + Intronic
1123648364 15:22459590-22459612 TGACCCCAAAGAGCCCCGGGAGG - Intronic
1123729977 15:23136095-23136117 TGACCCCAAAGAGCCCCGGGAGG + Intronic
1123748147 15:23333577-23333599 TGACCCCAAAGAGCCCCGGGAGG + Intergenic
1124280511 15:28357429-28357451 TGACCCCAAAGAGCCCCGGGAGG + Intergenic
1124302187 15:28554183-28554205 TGACCCCAAAGAGCCCCGGGAGG - Intergenic
1128315953 15:66659497-66659519 TTCCCCCAAAGAGACCTGGCTGG - Intronic
1128532629 15:68464987-68465009 TCTCCCCAGAGGGCCCCGGCTGG + Intergenic
1129152100 15:73695836-73695858 GTTGCCCAAGGAGCCCCTGCGGG + Intronic
1129688740 15:77701240-77701262 TTCCCCCAAAAAGACCCCCCAGG - Intronic
1130063423 15:80585716-80585738 TTTCCCCAGGGAGTGCCCGCAGG + Intronic
1134849647 16:17470177-17470199 AACCCCCAAAGCGCCCCCGCTGG + Intronic
1136609378 16:31357020-31357042 TGTCCCCACAGTGCCCCCGGAGG + Exonic
1137777811 16:51071172-51071194 TTCTCCCTTAGAGCCCCCGCAGG + Intergenic
1140202092 16:72903063-72903085 GTTCCCCATAGAGCCCTCTCTGG - Intronic
1141564747 16:84893684-84893706 TGTCCCCAAGGAGTCCCCTCTGG - Intronic
1141853422 16:86664361-86664383 TTTCCCCAAAGAGGCCGTGGCGG - Intergenic
1142161931 16:88562097-88562119 TTTCCTCAAAGAGCCACCAGAGG - Intergenic
1143117546 17:4589295-4589317 TTTCCCCCCAGAGCCCCGCCTGG + Intronic
1147420869 17:40321644-40321666 CTGCCCCAAAGGGCCCCTGCTGG + Intronic
1147951695 17:44111222-44111244 CTTCCCGAATGAGCCGCCGCCGG + Intronic
1148089369 17:45013662-45013684 CTCCCCCAGAGAGCCCCTGCTGG + Intergenic
1152351808 17:79788124-79788146 TTCCCCCAAAAAGCCCCTGATGG + Intergenic
1152625536 17:81386530-81386552 TTTCCCCAAGCAGCCCCCACAGG + Intergenic
1154497403 18:14972369-14972391 TTTCCTCAGAGAGCCCACGGAGG + Intergenic
1156831879 18:41501762-41501784 TTTCCCCAAAGAACCACTGATGG + Intergenic
1159118892 18:64146601-64146623 TTTGCCCACAGAAGCCCCGCTGG - Intergenic
1160791020 19:923815-923837 TTCCCCCAAAGGGGCCGCGCAGG - Intergenic
1164929526 19:32164768-32164790 TGTCCCCAAAGACCCCCCACTGG + Intergenic
1168316148 19:55485597-55485619 TGTCCCCAAAGCTCCCCCGAGGG - Intronic
927204738 2:20600020-20600042 TTTGGCCAAAGAGCCCCCAGGGG - Intronic
929121712 2:38489235-38489257 TTTCCCCAGAGAGGCCCCTCTGG + Intergenic
932180114 2:69639502-69639524 TTCCCCCAAACAGCCCCTGCTGG + Intronic
932217839 2:69978270-69978292 TTTCCCCAAGGAGACTCCCCTGG - Intergenic
934946216 2:98543812-98543834 TTTCCCCAGAGAGGCCCAGGAGG - Intronic
937003667 2:118491353-118491375 TTTTCCCAAAGAGCTGCCGAAGG - Intergenic
940722243 2:157294652-157294674 TTTCCCCCATGAGCCCCAGTAGG + Intronic
942413956 2:175738939-175738961 TTTAACCAAAGAACCCCAGCGGG + Intergenic
944510203 2:200456931-200456953 TTTCCCCAATGAGTCCTGGCAGG + Intronic
948483400 2:238264403-238264425 TTTACCCATAGAGCCTCCCCAGG + Intronic
1168892103 20:1301249-1301271 TGTCTCCCAGGAGCCCCCGCAGG + Intronic
1178285590 21:31322881-31322903 TTTTCCCACAGAACTCCCGCAGG + Intronic
1179014875 21:37587849-37587871 TTTCCCCTCACAGCCCCAGCAGG - Intergenic
1179626404 21:42651998-42652020 TTTCCTCCAAGAGCCCCAGAAGG - Intergenic
1180020846 21:45125590-45125612 TTCCCCCAATGAGTCCCAGCAGG - Intronic
1180699019 22:17771789-17771811 TTTTCCCCAAGAGCCACTGCTGG - Intronic
1182061714 22:27403134-27403156 TTTCACCCAAAAGCCCCAGCAGG + Intergenic
1182326895 22:29520007-29520029 CTTCCCCAAAGAGCAGCCCCAGG - Exonic
1183623622 22:38988993-38989015 TCTCCCCAATGATCCCCCTCAGG + Intronic
1184516255 22:44964616-44964638 TTTCCCCAAAGACCTCACCCTGG - Intronic
1184666625 22:45992703-45992725 TGTCCCCATAGGGCCCCTGCAGG + Intergenic
1184738446 22:46412623-46412645 TTTCCCCAGACAGCCCTCGCAGG + Intronic
1185294084 22:50044890-50044912 TCTCCCCAAAGGGGCCCCGTGGG - Intronic
950664515 3:14487146-14487168 TTCACCCAGGGAGCCCCCGCTGG - Exonic
952917912 3:38263435-38263457 ATTCCTCAAAGATCCCCTGCAGG - Intergenic
962856752 3:139353461-139353483 TTTCCACAAAAAGCCCTTGCTGG + Intronic
967055269 3:185824885-185824907 TGTCCCCAAAGAGCTGCCGGAGG + Exonic
967617642 3:191591412-191591434 TTTCCCTGAAGAGCTCCCACTGG + Intergenic
967896152 3:194397418-194397440 TCTCCCCGAAGAGCACCCCCGGG + Exonic
975075179 4:70198077-70198099 TTTGCCCAAGGAGCCCAGGCAGG + Exonic
978252487 4:106649784-106649806 TTTCCACACAGAGTCCCCACTGG + Intergenic
979180594 4:117721702-117721724 TCTCCCCACAGAGTCCCCACTGG + Intergenic
986963372 5:13242099-13242121 GTTCCCGACAGAGCCCCTGCAGG + Intergenic
988006093 5:25412947-25412969 TTTCCCCAATGAGTCCCTACTGG + Intergenic
998586472 5:143432416-143432438 TTTCCACAAAGATGCCCCTCAGG - Intronic
1001519546 5:172381388-172381410 TTTCCCCAAAGCACCCGGGCCGG + Intronic
1004851906 6:19708055-19708077 TTTCCCCACTGAGTCCCAGCTGG - Intergenic
1005480456 6:26250284-26250306 TGTCCTCAAAGAGCCCCACCAGG + Exonic
1005642561 6:27810373-27810395 TGTCCTCAAAGAGCCCCACCAGG - Exonic
1006794073 6:36721211-36721233 TGTCCCCAAATAGCCCAGGCAGG - Exonic
1007284600 6:40738399-40738421 TGTCCCCAGGGAGCCCCAGCCGG - Intergenic
1015796401 6:137016241-137016263 TGTCCCCATGGAGCCCCAGCTGG - Intronic
1018891738 6:167987719-167987741 TCACCCCGAAGGGCCCCCGCCGG + Intergenic
1029640636 7:101817038-101817060 TTTCCCCAAAGAGCCCCCGCGGG - Intronic
1036449081 8:8849598-8849620 TGGCCCCAAAGAGCCTCCCCTGG + Intronic
1039457563 8:37717612-37717634 TTGGCCCAGAGAGCCCCTGCTGG - Intergenic
1039835543 8:41253610-41253632 TTTCCCCAGGGAGCCCCACCAGG + Intergenic
1040699037 8:50038971-50038993 GTTCCCCAAAGGGCTCCTGCAGG - Intronic
1045971318 8:108082691-108082713 TTCGCCCAAAGAGCCGGCGCCGG + Exonic
1046750606 8:117922865-117922887 TTTCTGCAAAGAGCCCACACTGG + Intronic
1051249657 9:15146520-15146542 TTCCCCCAAAGAGGATCCGCTGG - Intergenic
1057090125 9:92250459-92250481 TCTCCCCAAGGAGCCCCCATGGG + Intronic
1060236798 9:121869851-121869873 TTGCCCCAAAGTGCCCCCACAGG + Intronic
1061410702 9:130419789-130419811 TTTCTCCAATGAGCCCTCCCAGG + Intronic
1061511939 9:131067000-131067022 GGTGCCCAAAGAGCCCCAGCGGG - Exonic
1061921046 9:133782705-133782727 ATTCAACAAAGAGCCCCCGGTGG - Intronic
1062432046 9:136530575-136530597 TGTCACCAAAGTGCCCCCGCAGG + Intronic
1191111146 X:56803888-56803910 TTTCCCCAAAGAGACCATGTAGG - Intergenic
1197177636 X:123502183-123502205 TTGCTCCAGAGAGCCCCCTCGGG + Intergenic
1200119063 X:153781901-153781923 CTGCCCCACAGAGCCCCGGCAGG - Intronic
1200595026 Y:5129380-5129402 CTTCCCCAAAGAGCAACCACTGG + Intronic
1200935308 Y:8733141-8733163 CTTTCCCAGAGAGCCCCTGCGGG - Intergenic