ID: 1029646154

View in Genome Browser
Species Human (GRCh38)
Location 7:101857240-101857262
Sequence CAGGCAAAATGCCCTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029646154 Original CRISPR CAGGCAAAATGCCCTGTAGG AGG (reversed) Intronic
901180745 1:7340275-7340297 CTGGAAAAATGCCCTGGAGAAGG + Intronic
901678287 1:10899272-10899294 CATAGAAAATACCCTGTAGGGGG + Intergenic
901776306 1:11562828-11562850 CAGGTCACATGGCCTGTAGGAGG - Intergenic
903182274 1:21610914-21610936 AAGGCAGATAGCCCTGTAGGAGG + Intronic
907152042 1:52297968-52297990 CAGGCAAAAGGCACTTTGGGAGG - Intronic
907937812 1:59058188-59058210 CAGGCAAAAAGGCCTTGAGGTGG + Intergenic
909611325 1:77554536-77554558 AAGGCAAAGAGCCCTGTATGAGG - Intronic
912210426 1:107551010-107551032 GAGGCAAAATGCCAGATAGGAGG + Intergenic
913375774 1:118150565-118150587 AAGGCAAAAAAACCTGTAGGTGG - Exonic
916337842 1:163693069-163693091 CAGAAATAATTCCCTGTAGGAGG + Intergenic
916450674 1:164917506-164917528 CAGGACAAATGCCCTGGAGTTGG + Intergenic
916474790 1:165158949-165158971 CAGGCAAGATGACCTGGGGGAGG - Intergenic
917773900 1:178312509-178312531 CAGGAAAAATGATGTGTAGGAGG - Intronic
918140528 1:181715941-181715963 CAGGCAAGATGCCTTGTGTGAGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
924147995 1:241097205-241097227 CAAGCAGAATGGCCTGTAAGTGG + Intronic
924183202 1:241460037-241460059 CAGTCATAATGCCCTACAGGAGG + Intergenic
924898528 1:248369556-248369578 CAGGCAATGTGCCCTTTAAGAGG - Intergenic
1067242210 10:44506588-44506610 CCTGCAAACTGTCCTGTAGGGGG - Intergenic
1070676645 10:78416302-78416324 TAGGGAAAATTGCCTGTAGGAGG - Intergenic
1072622007 10:97086196-97086218 CAGCCAAAATGGCCTTTAGTAGG + Intronic
1073475163 10:103747738-103747760 CAGGCAAACTCCCCTGTGGCTGG - Intronic
1075789138 10:125071009-125071031 AAGACAAAATGCCCCGTATGCGG + Intronic
1076078726 10:127558603-127558625 CAGGCGCAAAGCCCAGTAGGTGG - Intergenic
1076401334 10:130187266-130187288 CAGGCAAAAAGTGCTGTTGGAGG + Intergenic
1079274499 11:19021917-19021939 CAAGAAAAAGGCCCTGTAGCAGG - Intergenic
1079297560 11:19246809-19246831 CAGCCAACATGTCCTGTAGCTGG - Intergenic
1079406775 11:20154629-20154651 CAGGAAAAATGCCTTCAAGGAGG + Intergenic
1083694943 11:64436538-64436560 CATGAAAAAGGCCCTGGAGGGGG + Intergenic
1083816834 11:65137566-65137588 CAGGCATAATGCCCAGTTGTGGG + Intergenic
1084210170 11:67617126-67617148 CAGCCAAGATCCCCTGCAGGGGG - Intergenic
1085290267 11:75393832-75393854 CAGCCAAAAAGCCCTGAAGTAGG - Intergenic
1085473550 11:76773503-76773525 CAGGCAAAGTGTCCTGAGGGAGG - Intergenic
1085798399 11:79564718-79564740 CAGCCAAAATGGCATGTCGGAGG - Intergenic
1086584200 11:88432860-88432882 CAGGCAACTTGCCCTGTAGCTGG - Intergenic
1086767845 11:90720885-90720907 CAACCAAAATGCCCTTTAGTAGG + Intergenic
1088960688 11:114661949-114661971 CTGGTAAAAGGACCTGTAGGAGG + Intergenic
1098880180 12:75909326-75909348 CATGCAAAATGCTCTGCAGCTGG + Intergenic
1103791723 12:123476903-123476925 AAGGCAAAATACGCTGTGGGAGG + Intronic
1104187134 12:126443773-126443795 CGGGCAAAATTCCCGGTGGGAGG - Intergenic
1104402365 12:128486671-128486693 CAAGCAAATTACCCTGTGGGAGG + Intronic
1104772495 12:131372331-131372353 CAGGCAAGATTACCTGCAGGCGG - Intergenic
1112094750 13:96120104-96120126 CAGGAAGAATGCCCTGTGAGAGG + Intronic
1113321694 13:109238663-109238685 AAGGGAAAATGCAATGTAGGAGG + Intergenic
1115163598 14:30423389-30423411 CAGTCAACATGGCCTGTAAGAGG - Intergenic
1117211291 14:53503021-53503043 TAGGGAAAATGCCCTGAAGATGG - Intergenic
1118554644 14:67003466-67003488 CAGGTAAAATGCCTTGAAGTAGG - Intronic
1120896109 14:89534014-89534036 CAGGCAAAATTCCCAGGAAGGGG - Intronic
1129256275 15:74335851-74335873 CAGGCAATATGCCCTTGAGCAGG + Intronic
1129831739 15:78675338-78675360 CATGCAAAACGCCAAGTAGGGGG - Intronic
1134031453 16:10995619-10995641 CAGGCAAAATGCCTGGTACAAGG - Intronic
1137696708 16:50466535-50466557 CAGGCAAAATACCTGGTAGAAGG - Intergenic
1140457188 16:75112350-75112372 CAGGCAAAGTGCTGTGAAGGGGG - Exonic
1144150416 17:12437736-12437758 CAGTCGAAATGCCCTGAGGGAGG + Intergenic
1145884050 17:28370627-28370649 CAGACAAAATGCCCAGTAGCTGG + Exonic
1146659322 17:34653805-34653827 CAGGCAGAATGCCAAGTTGGAGG - Intergenic
1148697168 17:49567589-49567611 CAGGGAAATTGCCCTGAGGGTGG - Intergenic
1152621345 17:81366381-81366403 CAGGCTAAATGCCTGGGAGGGGG + Intergenic
1153399491 18:4667357-4667379 CAGCCAAAGTGCTTTGTAGGTGG - Intergenic
1155082754 18:22427140-22427162 CATGGAAAAGGCCCTGAAGGAGG - Intergenic
1155690952 18:28621643-28621665 CAAGCAAAATGACCTATAGCAGG + Intergenic
1161847727 19:6721236-6721258 CAGGGAAAACTTCCTGTAGGAGG + Intronic
1163712318 19:18854086-18854108 CAAGCAAACTGCCCTCCAGGAGG - Intronic
1163757674 19:19116181-19116203 GAGGGAAGATGCCCTGCAGGGGG - Intergenic
925571718 2:5319386-5319408 CAGGTTACATGCTCTGTAGGGGG - Intergenic
926092832 2:10061610-10061632 CACCCGACATGCCCTGTAGGTGG + Intronic
926372396 2:12193074-12193096 CAGGGCAAATCCCCTGTATGGGG - Intergenic
929900275 2:45994683-45994705 CAAGCAAAATGTCCTTTAGTAGG - Intronic
930408503 2:50993648-50993670 CTGGTAAAATGCCATGTAAGTGG + Intronic
931640240 2:64375362-64375384 CAGGCAATATGACCTCAAGGTGG - Intergenic
935705596 2:105854258-105854280 CAAGCAAAATGTCCTTTAGTAGG - Intronic
936236441 2:110746534-110746556 CAGGCAACATGCCCAGGAGCCGG - Intronic
939003763 2:136764324-136764346 CAGGCAAAATATCCTGTAATTGG + Intergenic
942277952 2:174336336-174336358 CAGGCAGAAGGCGCTGTTGGCGG - Exonic
946969953 2:225080441-225080463 CTGACAAAATGCCCTGTGGCAGG - Intergenic
947583101 2:231333875-231333897 CCGGCAAAATGCCATGGGGGAGG + Intronic
948470359 2:238173514-238173536 CAGGTAAAAGGCCCTATAAGAGG - Exonic
1178022983 21:28431108-28431130 AAGGCAACATGCCCTGGTGGAGG + Intergenic
1182372134 22:29818824-29818846 CAGGAAAAAGGCCCTTTGGGAGG - Intronic
1184695373 22:46135922-46135944 CAGGCAAGATGCCCTCCATGGGG + Intergenic
1184794686 22:46725074-46725096 CAGGGACAATGGCCTGAAGGAGG - Intronic
950949765 3:16986082-16986104 CAGGCACAAGGAGCTGTAGGGGG + Intronic
952288881 3:31995936-31995958 CTGACAAAATGCCCTGTGGAGGG + Intronic
953455999 3:43042888-43042910 CAGGGAAGATGCCATGTATGTGG + Intronic
954122085 3:48505261-48505283 CAGGCAGGATGCCCTCTGGGAGG + Intergenic
957624447 3:82641007-82641029 CAGAGAAAATGCCCTGGAGTGGG - Intergenic
959551417 3:107663576-107663598 CAGGCAAAATTTAATGTAGGGGG - Intronic
960088839 3:113618324-113618346 CAATCAAAATGCCCTTTAGTGGG - Intronic
960434766 3:117612350-117612372 CAGGCATAGTACCCAGTAGGTGG - Intergenic
962885225 3:139619046-139619068 TAGGGAAAATTCCCTGGAGGAGG - Intronic
963102454 3:141620405-141620427 AAGACAAAATGGCCTGGAGGTGG + Intergenic
963130671 3:141855042-141855064 CAAGCAAACTGCCCTGTAGGTGG + Intergenic
963561871 3:146876025-146876047 CAGCCAAAATGCCCAGTAGAGGG + Intergenic
965249470 3:166324374-166324396 CAGGAAACATACCCTGTTGGTGG - Intergenic
965261871 3:166497172-166497194 CAGGAAAAATGTCCTTTAGGTGG - Intergenic
967806609 3:193719710-193719732 CAGGAAGGATGCCCTGGAGGTGG + Intergenic
968614160 4:1569853-1569875 CAGGCAACATGCCATGGGGGAGG + Intergenic
969184236 4:5463685-5463707 GAGGCTCACTGCCCTGTAGGTGG - Intronic
973745049 4:53956066-53956088 CTGGCAGAATGCCCTGTGGTGGG + Intronic
977685404 4:99841774-99841796 CACCCAAAATGCCCTGCAGTGGG - Intronic
978446646 4:108786879-108786901 CAGTCCAAAGGCCCTGTGGGAGG - Intergenic
981932690 4:150208093-150208115 CAGGGAAAATCCCCTGTACTTGG - Intronic
982934563 4:161455835-161455857 CAGGAAAAAGGCCCTTTAGAAGG - Intronic
982972932 4:162013964-162013986 AAGCCAAAATGCACTGTATGAGG + Intronic
986782517 5:11079634-11079656 CAGGGAAAAGGCCCTGGAGAGGG - Intronic
989625771 5:43428353-43428375 CAGGCAGCAGGCCCTGCAGGAGG - Intergenic
991479871 5:67066615-67066637 CAGCCAAAATGTCCATTAGGGGG - Intronic
1003869013 6:10387203-10387225 CAGCCAAAATGCTCAGTAAGGGG + Intergenic
1007173914 6:39883579-39883601 CAGGCAACCTGCCCTTTAGGGGG + Intronic
1008824421 6:55676010-55676032 CAGGCAAAATTGGCTGTAGGTGG - Intergenic
1013734265 6:113207343-113207365 CAGGCAAAATGTCCAGGATGGGG - Intergenic
1017508001 6:155086404-155086426 CATCCAAAATGACCTGTAGTTGG + Intronic
1017704212 6:157106049-157106071 CAGGGAAAATTCCCTGAAGTGGG - Intronic
1019058151 6:169237380-169237402 CAGGCAAATACCCCTCTAGGCGG - Intronic
1026772928 7:73213553-73213575 CAGGGAAATTGCCAGGTAGGAGG - Intergenic
1027013791 7:74766949-74766971 CAGGGAAATTGCCAGGTAGGAGG - Intergenic
1027074247 7:75179083-75179105 CAGGGAAATTGCCAGGTAGGAGG + Intergenic
1029646154 7:101857240-101857262 CAGGCAAAATGCCCTGTAGGAGG - Intronic
1033265517 7:139883106-139883128 CAAGCACACTGCCCAGTAGGTGG + Intronic
1036918585 8:12830112-12830134 CAGGCAAAATGTCCTTCAGTGGG - Intergenic
1039453488 8:37693951-37693973 AAGGCAAAATGGCTTGTGGGTGG + Intergenic
1043291177 8:78603427-78603449 CAGTTGAAATGCCCTGTAGAAGG - Exonic
1043691048 8:83152340-83152362 CAAGGAAAATGCCCTGTAGGAGG - Intergenic
1045387579 8:101686441-101686463 CAGGAAAAATACCCAGGAGGAGG + Intergenic
1045897552 8:107237431-107237453 CAGGCAAAATGGGGTGTTGGGGG + Intergenic
1046248746 8:111602130-111602152 CTGTCAAAATGCCCTGTTGTGGG - Intergenic
1048016438 8:130501543-130501565 CAAGCAAAATGCCATGTATTTGG + Intergenic
1048018571 8:130518942-130518964 AAGTCAACCTGCCCTGTAGGTGG - Intergenic
1048182112 8:132204954-132204976 CATGTAAGATGCTCTGTAGGAGG - Intronic
1050891907 9:10835271-10835293 CAGGCAAGATGCCCTGAAGTAGG - Intergenic
1052711213 9:32058469-32058491 CAGGCAAAATTAATTGTAGGTGG + Intergenic
1056614349 9:88150798-88150820 CAGGCAAAGTGGGCTGTAGTTGG + Intergenic
1056919605 9:90774502-90774524 CAGGTGAACTGCTCTGTAGGGGG - Intergenic
1061358930 9:130128487-130128509 TAAGGAAAATGCCCTGTAGCAGG + Intronic
1185619027 X:1442203-1442225 CAAGCAGAAGGCCCTGGAGGTGG - Exonic
1186747199 X:12582502-12582524 CTGGCAAACTCCCCTGTGGGAGG + Intronic
1187027248 X:15448406-15448428 CAGGCTACATGGCCTGTAGCAGG + Intronic
1191949567 X:66573722-66573744 CAGGAAAACTGCCCTATAAGAGG - Intergenic
1193193913 X:78607040-78607062 CAGGCAAAATCCACTGGAGGTGG + Intergenic
1195389039 X:104341776-104341798 CAGGCTAAATGCATTGGAGGTGG + Intergenic
1195734096 X:107995664-107995686 CAGGAAAAATGGCAGGTAGGAGG + Intergenic
1197290407 X:124649599-124649621 CAGGCAACTTGCTCTGTAGCAGG - Intronic
1197305884 X:124841683-124841705 CAGGTAAAAGGACCAGTAGGTGG - Intronic