ID: 1029646605

View in Genome Browser
Species Human (GRCh38)
Location 7:101860788-101860810
Sequence AGAGAGAAGAAGAGAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7485
Summary {0: 1, 1: 16, 2: 124, 3: 1034, 4: 6310}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029646605_1029646610 19 Left 1029646605 7:101860788-101860810 CCTTCCCCTCTCTTCTTCTCTCT 0: 1
1: 16
2: 124
3: 1034
4: 6310
Right 1029646610 7:101860830-101860852 AGAGTCTTGTTGTGTCACCCAGG 0: 11
1: 981
2: 14277
3: 52754
4: 112164
1029646605_1029646611 23 Left 1029646605 7:101860788-101860810 CCTTCCCCTCTCTTCTTCTCTCT 0: 1
1: 16
2: 124
3: 1034
4: 6310
Right 1029646611 7:101860834-101860856 TCTTGTTGTGTCACCCAGGCTGG 0: 34
1: 3155
2: 36709
3: 92330
4: 174533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029646605 Original CRISPR AGAGAGAAGAAGAGAGGGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr