ID: 1029651056

View in Genome Browser
Species Human (GRCh38)
Location 7:101892038-101892060
Sequence CCTTTTAGGGAGTGGATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029651056_1029651061 1 Left 1029651056 7:101892038-101892060 CCAGAAATCCACTCCCTAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 157
Right 1029651061 7:101892062-101892084 TTGTTGAATGAATCAGATCTAGG No data
1029651056_1029651062 20 Left 1029651056 7:101892038-101892060 CCAGAAATCCACTCCCTAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 157
Right 1029651062 7:101892081-101892103 TAGGAGCATCTCTTTTGTGTTGG 0: 1
1: 0
2: 2
3: 12
4: 183
1029651056_1029651063 25 Left 1029651056 7:101892038-101892060 CCAGAAATCCACTCCCTAAAAGG 0: 1
1: 0
2: 1
3: 13
4: 157
Right 1029651063 7:101892086-101892108 GCATCTCTTTTGTGTTGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029651056 Original CRISPR CCTTTTAGGGAGTGGATTTC TGG (reversed) Intronic
901094236 1:6665474-6665496 CATTTTAAGGAGAGGATTTGAGG - Intronic
902159413 1:14518013-14518035 CATTTTTGGGATTGGAGTTCTGG + Intergenic
902639364 1:17756682-17756704 CCATTTTGGGAGTGGTTTTCTGG + Intronic
903862626 1:26374135-26374157 CCTTTTAGGGAGTAGAGTTTTGG - Intronic
908018854 1:59878791-59878813 GCTTTTATGGAATGGATTTTTGG + Intergenic
909304018 1:74049178-74049200 CCTCTTACTTAGTGGATTTCAGG - Intronic
911056879 1:93716533-93716555 CCTTTTAGGGCCTGGTTTTGGGG - Intronic
915017935 1:152753923-152753945 CCTTGAAGGGACTAGATTTCAGG - Intronic
916812508 1:168317905-168317927 CTTTTTAGGGGGTGGAGTTTGGG + Intergenic
918977589 1:191510732-191510754 CCTTTTTGGGGTTGCATTTCAGG + Intergenic
921617482 1:217287011-217287033 ACTTTTAAGGAATGCATTTCGGG + Intergenic
924245870 1:242084038-242084060 CTTTTTATGAAGTGGATATCTGG - Exonic
924563966 1:245180595-245180617 CCTTTAAGAGAGGGGATTTGTGG + Intronic
1063188552 10:3671575-3671597 CCCTTTAGGGAAGGGATTACTGG + Intergenic
1064993968 10:21280387-21280409 CCCTTTAGGAGTTGGATTTCGGG + Intergenic
1067229403 10:44396135-44396157 CCTTTTTGGTTGTGGATTTGGGG + Intergenic
1069296136 10:66846691-66846713 TCTTTTTAGGAATGGATTTCTGG + Intronic
1070455026 10:76604777-76604799 CCTTTTGGGGAGAGGACTTGCGG - Intergenic
1071457469 10:85861873-85861895 CCATTTTGGGGGTGGAGTTCAGG + Intronic
1072540445 10:96394350-96394372 CCTCTTAGGGTGTGGTCTTCAGG + Intronic
1074542429 10:114376125-114376147 CCTTTAAGGGGGTGGCTTTTTGG - Intronic
1074564304 10:114563200-114563222 CCTCTTAGTGATGGGATTTCGGG + Intronic
1075897575 10:126010485-126010507 CGTTTTAGGAATTGGATTTGTGG + Intergenic
1076436454 10:130447981-130448003 CTTCTAAGAGAGTGGATTTCGGG - Intergenic
1078641667 11:13102403-13102425 CCTTTTAAGGTTTGGATTTGGGG + Intergenic
1080560620 11:33459312-33459334 CATTTTGGGGAGGGGAGTTCTGG + Intergenic
1080829196 11:35875733-35875755 CCTTTTAAGAAGTGAATCTCTGG - Intergenic
1080836136 11:35942965-35942987 CCTTTTGAGGGGTGGATTTTAGG + Intergenic
1089811892 11:121138835-121138857 CATTTTAGGGAGCTGATTTAGGG + Intronic
1092464078 12:8712576-8712598 CCTTTGAGGCAGTGGATTGTGGG + Intronic
1095202593 12:39401781-39401803 CCTTTTAGAAATGGGATTTCAGG + Intronic
1097291231 12:57916990-57917012 GCTTTTAAGGAGTGATTTTCAGG + Intergenic
1101416434 12:104512701-104512723 TTTTTTAGGGAGTTGAATTCAGG + Intronic
1101944368 12:109125063-109125085 CCTTTCAGGGACTGTATTTCAGG - Intronic
1102320268 12:111927282-111927304 CCTTTTAAGAACTGGACTTCGGG + Intergenic
1102320459 12:111929158-111929180 CCTTTTAAGAAATGGACTTCTGG + Intergenic
1105502284 13:20983018-20983040 TTTTTAAGGTAGTGGATTTCAGG - Intronic
1107819047 13:44269868-44269890 CCTTTTGGGGAGATGCTTTCAGG - Intergenic
1111564199 13:89993014-89993036 CCTTTTAGTGACTGGAATACAGG + Intergenic
1113948199 13:114056699-114056721 CTTTTTATTGAATGGATTTCTGG - Intronic
1115529061 14:34309805-34309827 CCATTTAGAAAGTGCATTTCAGG + Intronic
1116382621 14:44290120-44290142 GCTTTGGGGGAGAGGATTTCTGG - Intergenic
1119651024 14:76382926-76382948 CTTTTCAGGGAATGGTTTTCTGG + Intronic
1120275061 14:82362662-82362684 CCTTTTAGGGAGAGAATATTTGG - Intergenic
1123734729 15:23174887-23174909 CCGTTAAGGGACTGGGTTTCCGG + Intergenic
1124285231 15:28396185-28396207 CCGTTAAGGGACTGGGTTTCCGG + Intergenic
1124297465 15:28515429-28515451 CCGTTAAGGGACTGGGTTTCCGG - Intergenic
1129595102 15:76957741-76957763 CCTTCTGAGGAGTGGCTTTCTGG - Intergenic
1129897232 15:79117542-79117564 CCTTTTGGGCAGTGGAGTGCAGG - Intergenic
1130290468 15:82595319-82595341 TCTCTTAAGGAGTGAATTTCTGG + Intronic
1132047242 15:98574737-98574759 CATTTTAGTGAGTGGTTTCCTGG - Intergenic
1133804949 16:9118799-9118821 CCTTTTAGGAATAGGAGTTCTGG - Exonic
1134509539 16:14834859-14834881 CATTTTTGGGAGGGGATTTATGG + Intronic
1134697244 16:16233675-16233697 CATTTTTGGGAGGGGATTTATGG + Intronic
1137868961 16:51931002-51931024 CCTTCTAGGAAGTGGATTCTGGG - Intergenic
1140699320 16:77566791-77566813 CATTTGAGGGAGTCTATTTCTGG + Intergenic
1141356491 16:83351407-83351429 CATTTTAGTGAGTGCAGTTCTGG + Intronic
1143012136 17:3871957-3871979 TCTTTTCAGCAGTGGATTTCAGG - Intronic
1145846471 17:28042507-28042529 CCTTTTCGTGTGTGGAGTTCAGG + Exonic
1147413338 17:40270025-40270047 TTTTTTAGGGACTGGAGTTCTGG + Intronic
1147523531 17:41198145-41198167 ACTTCTAGGGATTGGATTTAGGG + Intronic
1148226466 17:45901205-45901227 CCTGGCATGGAGTGGATTTCAGG - Intronic
1148271400 17:46264802-46264824 CATTTCAGGGTGTGGGTTTCAGG + Intergenic
1149224730 17:54456280-54456302 CCTTTTTGGTAGTGTATTTAGGG - Intergenic
1150765512 17:67998828-67998850 CATTTCAGGGTGTGGGTTTCAGG - Intergenic
1151883890 17:76912081-76912103 CCTTATAGGGAGGGGAAATCTGG - Intronic
1159394982 18:67845141-67845163 CCTTTTAAGCACTGTATTTCTGG - Intergenic
1161760144 19:6165117-6165139 CAGTTCAGGGCGTGGATTTCAGG + Intronic
1163733289 19:18962548-18962570 CCATGGAGGGAGTGGATTTTGGG + Intergenic
1168433741 19:56301995-56302017 CCTCTTGGGGAGTGGTTTCCTGG - Exonic
1202646318 1_KI270706v1_random:145255-145277 CCTCTTAGTGAGTAGATTTGTGG - Intergenic
925965812 2:9064825-9064847 CCTTTGAGGGAATGCATCTCAGG - Intergenic
926920345 2:17934300-17934322 CGTGTTAGGGAGTGGATTTAAGG + Intronic
927320212 2:21735034-21735056 CCTGTTTGGGAGTGGAGTGCGGG + Intergenic
929573476 2:43038317-43038339 TCTTTCAGGGAGTCTATTTCTGG - Intergenic
934509464 2:94925694-94925716 CCTGTTAGGTAGTAGATTTGTGG - Intergenic
935264352 2:101381906-101381928 CCTCATGGGGAGAGGATTTCAGG - Intronic
935740075 2:106139458-106139480 CCCTTTAGGGAGTTCATTTGTGG - Intronic
936391861 2:112082099-112082121 ACTTCTAGAAAGTGGATTTCAGG + Intronic
936428482 2:112437868-112437890 CCTCTTAGGGACTGGATCGCGGG + Intergenic
939385952 2:141498598-141498620 TTTTTAAGGGACTGGATTTCTGG - Intronic
939817809 2:146917661-146917683 CCTTTAAGGCAGTGGGTTTCTGG - Intergenic
941030910 2:160510736-160510758 AATTTTAAGGAGTGGAGTTCAGG - Intergenic
943447618 2:188007698-188007720 CCTTTGAGGTACTGGATTTGAGG - Intergenic
943657729 2:190527406-190527428 CCTTTTATGGAGTTGTGTTCTGG - Intronic
945544134 2:211127747-211127769 TCTTTCTGGGAGTGTATTTCAGG - Intergenic
945997224 2:216447790-216447812 CCATTTTGGGAGAGCATTTCTGG - Intronic
946292247 2:218754227-218754249 CCTTTGAGGAACTGGGTTTCTGG - Exonic
1170409733 20:16075783-16075805 GCTTTGAGGGAGTGGCTTTCAGG + Intergenic
1170485765 20:16814696-16814718 CTTTCTATGGAGTGGCTTTCAGG + Intergenic
1171097892 20:22349747-22349769 ATTTTTTGGGACTGGATTTCAGG - Intergenic
1171411218 20:24950027-24950049 ACCCTCAGGGAGTGGATTTCAGG - Intronic
1173088573 20:39948698-39948720 CCTTTTAGTAACTGTATTTCAGG - Intergenic
1174006801 20:47417320-47417342 CTTTTTAGGAAGTGGCTCTCCGG - Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174883991 20:54311657-54311679 CATTTTAGAGTGTGTATTTCTGG + Intergenic
1176373670 21:6077003-6077025 CCTCTTAGGGACTGGATCGCGGG - Intergenic
1176605554 21:8827503-8827525 CCTCTTAGTGAGTAGATTTGTGG + Intergenic
1177844602 21:26273967-26273989 CCTTTAAGGGACAGGATTGCTGG - Intergenic
1178171364 21:30043851-30043873 GCTTTTATGCAGTGGATTTTTGG + Intergenic
1178602031 21:34002833-34002855 CCTTCCAGGCAGTGGCTTTCAGG - Intergenic
1179749807 21:43461240-43461262 CCTCTTAGGGACTGGATCGCGGG + Intergenic
1180054866 21:45352553-45352575 CCTTGTATGGTGTGGATTTCTGG - Intergenic
1180347851 22:11719108-11719130 CCTCTTAGTGAGTAGATTTGTGG + Intergenic
953700063 3:45188609-45188631 ACTTTGAGGTAGTGGTTTTCTGG - Intergenic
962613137 3:137097884-137097906 CCTGCTCTGGAGTGGATTTCAGG + Intergenic
967995786 3:195165344-195165366 CCTTTCTGGGAGAGGATCTCAGG - Intronic
969089416 4:4682554-4682576 CCTTATAAGGAGAGGATTTTGGG - Intergenic
971404730 4:26312041-26312063 CGTCTTAGGGAGTGGAACTCAGG + Intronic
975358655 4:73440210-73440232 CCTGTCAGGGAGTGGAGTGCAGG - Intronic
975485985 4:74934238-74934260 CCTTTTCGGGAGACGTTTTCTGG - Intronic
975573943 4:75844510-75844532 CCTTCTAGGAAGTGGATTCCTGG + Intergenic
975664245 4:76719102-76719124 CTTTTTAGGGAGAAGATGTCTGG - Intronic
980830315 4:138123660-138123682 ACTGTTAGGGATTGGATTGCAGG + Intergenic
981403096 4:144337372-144337394 CCTCTCAGGGAGTGGATTTGAGG + Intergenic
983467623 4:168114639-168114661 CCTTTCAGAGGGTGGATTTTGGG - Intronic
986558223 5:9033176-9033198 CCATTTAGAGAGTGAATTCCAGG - Intergenic
986930335 5:12811284-12811306 ACTTTTTAGGAGTAGATTTCAGG - Intergenic
990555568 5:56931817-56931839 ACATTTATGGAGTGGTTTTCTGG - Intronic
991494952 5:67217621-67217643 CCTTATAGAGAGTGGTTTCCAGG - Intergenic
993034373 5:82740924-82740946 CCATGTAGGGAGTGGATTACTGG - Intergenic
997423034 5:133784363-133784385 CCTTTTAGAGGGTGGAGTTTGGG - Intergenic
997784256 5:136693391-136693413 GTTTTAAGGGAGTGGCTTTCAGG + Intergenic
1001420903 5:171586532-171586554 CATTTGAGGGATTGGTTTTCAGG + Intergenic
1005285472 6:24322094-24322116 CCTTTTGTGGAGAGAATTTCTGG + Intronic
1010509784 6:76704328-76704350 ACTTTTAAGGAGAGGATTTCTGG + Intergenic
1012349225 6:98230972-98230994 CCTTCTAGGAAGTGGATTAAGGG - Intergenic
1013463698 6:110399553-110399575 CCTTTCAGGGCGAGCATTTCAGG - Intronic
1015458569 6:133460986-133461008 CCTTTTAGAAAATGAATTTCTGG + Intronic
1015862310 6:137693732-137693754 TCTTTTAGGGAAGGGATTTTTGG + Intergenic
1015979002 6:138820098-138820120 CCTTGTAGGGGGTGGAAATCAGG - Intronic
1017745231 6:157441153-157441175 CCTTTTAGGAGGTGGAAGTCAGG + Intronic
1017889310 6:158625826-158625848 CCTTTTGTGGAGTGGATTTCAGG + Intronic
1018480957 6:164189909-164189931 CCTTTTTGGAAGTGGGTTGCCGG - Intergenic
1018811820 6:167303911-167303933 CCTTTCAGGGAGTGGTGTCCTGG + Exonic
1019900401 7:4016010-4016032 CATTTTAGGGCCTGAATTTCTGG + Intronic
1019950579 7:4369020-4369042 CCTTTTGGTGAGTAGGTTTCGGG + Intergenic
1020130185 7:5555247-5555269 CCTTTTATGGAGAGGAACTCGGG - Intronic
1023583945 7:41709498-41709520 CCTTTTGGAGAGAGGTTTTCTGG - Intergenic
1028498302 7:91487782-91487804 AGTTTTAGTGAGTGGATTTATGG + Intergenic
1029002769 7:97172907-97172929 CCTTTTGGGGATTGGTTTTGTGG + Intronic
1029651056 7:101892038-101892060 CCTTTTAGGGAGTGGATTTCTGG - Intronic
1030636321 7:111953378-111953400 CCTTTTAGGGAGAGGCTCTAGGG - Intronic
1034215015 7:149398553-149398575 CCTTTTATGGAGTGTCTCTCCGG + Intergenic
1038288439 8:26226960-26226982 CCTTTGAGGTAATGGGTTTCCGG - Intergenic
1038843526 8:31207873-31207895 CCTTCTAGTGTGTGAATTTCGGG + Intergenic
1040493077 8:47942635-47942657 CCATTAAGGAAGTGGACTTCTGG - Intronic
1040665546 8:49627332-49627354 CCTTATAAAAAGTGGATTTCAGG + Intergenic
1042119128 8:65465634-65465656 CCTTTCAGAGAGTAGAGTTCAGG - Intergenic
1043338819 8:79211674-79211696 CCTTCTCAGTAGTGGATTTCAGG + Intergenic
1048849803 8:138634308-138634330 CCTTGCAAGGAGAGGATTTCTGG - Intronic
1050854178 9:10330611-10330633 CCATTTAGGGAATGAATTTATGG - Intronic
1053655969 9:40218585-40218607 CCTGTTAGGTAGTAGATTTGTGG + Intergenic
1053906315 9:42847787-42847809 CCTGTTAGGTAGTAGATTTGTGG + Intergenic
1054352337 9:64028615-64028637 CCTGTTAGGTAGTAGATTTGTGG + Intergenic
1054368076 9:64364809-64364831 CCTGTTAGGTAGTAGATTTGTGG + Intergenic
1054528645 9:66157710-66157732 CCTGTTAGGTAGTAGATTTGTGG - Intergenic
1054675695 9:67854552-67854574 CCTGTTAGGTAGTAGATTTGTGG + Intergenic
1055086461 9:72319047-72319069 CTCTTTGGGGAGTGGGTTTCTGG + Intergenic
1056732696 9:89179495-89179517 CCTTTTTTGGAATGGATTTCTGG - Intergenic
1057372904 9:94490159-94490181 CCTATTAGGTAGTAGATTCCTGG + Intergenic
1058080791 9:100699184-100699206 TCTTATATGGAGTGGACTTCAGG - Intergenic
1059844700 9:118262051-118262073 CCTTTTAGGCAGTTTATTCCCGG + Intergenic
1060784330 9:126438139-126438161 CCTTTTGGGGAGAGAATATCTGG + Intronic
1062007540 9:134248613-134248635 ACTTTTAAGAATTGGATTTCCGG + Intergenic
1185917874 X:4056425-4056447 CCTTTCAGGGGCTGGAATTCAGG - Intergenic
1186902416 X:14071080-14071102 CCTTCTGGGGAGTGGAATTAAGG + Intergenic
1188029505 X:25248568-25248590 CCATTTAGGCACTGGATTTATGG + Intergenic
1188593197 X:31864428-31864450 CCTTTTTTGGAGTGTTTTTCTGG + Intronic
1190234092 X:48602759-48602781 CCTGTTAGGCAGTGGTTTTCAGG - Intronic
1197687856 X:129461537-129461559 CCTTTTAGGAAATGAATGTCAGG - Intronic
1201154227 Y:11115172-11115194 CCTGTTAGGTAGTAGATTTGTGG + Intergenic