ID: 1029652191

View in Genome Browser
Species Human (GRCh38)
Location 7:101901189-101901211
Sequence AGCTGGGCCCGCCCTACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029652191_1029652195 -8 Left 1029652191 7:101901189-101901211 CCCTGGGTAGGGCGGGCCCAGCT 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1029652195 7:101901204-101901226 GCCCAGCTCTGGAAGAAACAGGG No data
1029652191_1029652198 18 Left 1029652191 7:101901189-101901211 CCCTGGGTAGGGCGGGCCCAGCT 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1029652198 7:101901230-101901252 TACAAAAAATCACCCAATATTGG No data
1029652191_1029652194 -9 Left 1029652191 7:101901189-101901211 CCCTGGGTAGGGCGGGCCCAGCT 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1029652194 7:101901203-101901225 GGCCCAGCTCTGGAAGAAACAGG 0: 1
1: 0
2: 2
3: 15
4: 247
1029652191_1029652199 19 Left 1029652191 7:101901189-101901211 CCCTGGGTAGGGCGGGCCCAGCT 0: 1
1: 0
2: 0
3: 17
4: 172
Right 1029652199 7:101901231-101901253 ACAAAAAATCACCCAATATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029652191 Original CRISPR AGCTGGGCCCGCCCTACCCA GGG (reversed) Intronic
900241941 1:1621356-1621378 AGCTGGCTCTGCCCTCCCCACGG - Intronic
900313937 1:2047911-2047933 CCCTGGGCCTGCCCCACCCAAGG - Intergenic
900463375 1:2811793-2811815 AAATGGGCCGGCCCTCCCCATGG - Intergenic
900472964 1:2863591-2863613 AGCTGGGCCTGGCTTCCCCAGGG - Intergenic
900482128 1:2904474-2904496 AGCTCAGCCCTCCCTCCCCAGGG - Intergenic
900625850 1:3608195-3608217 AGCTGGGCTCCCCCAACCCCAGG - Intronic
901789815 1:11648223-11648245 AGCTGGGCCCGGCCTTGCCAGGG - Intergenic
902688552 1:18095241-18095263 AGCTGGGGCCTCCTGACCCAGGG + Intergenic
902927799 1:19708540-19708562 AGCGGGGCCAGCCCTTCCAAAGG + Intronic
904883955 1:33721717-33721739 TACTAGGCCTGCCCTACCCAGGG - Intronic
905172007 1:36115090-36115112 AGCTGGCCCTTCCCCACCCAGGG + Intronic
907280339 1:53343136-53343158 AGCTGGACCAGCCCTGCCCCAGG + Intergenic
907461337 1:54607486-54607508 AGCAGGGCCACCCTTACCCAGGG + Intronic
908241842 1:62194956-62194978 GCCTGGGCCAGCCTTACCCAGGG - Intronic
908241927 1:62195196-62195218 ACCTGGGCCAGCCTTACCCGGGG - Intronic
908322341 1:62990360-62990382 AGCTGTGCCTGCCAGACCCAAGG - Intergenic
910057093 1:83046042-83046064 TCCTGAGCCCTCCCTACCCATGG - Intergenic
920849072 1:209616404-209616426 GGCTGGTCCCACCCAACCCAAGG - Intronic
1063164722 10:3450790-3450812 AGGTGGGCCCGTTCTTCCCAAGG - Intergenic
1063367962 10:5502738-5502760 AGCTGAGCTCCCCCGACCCAGGG + Intergenic
1065307565 10:24383452-24383474 AGCTGGGGCCGGCTTGCCCAAGG + Intronic
1066656342 10:37702196-37702218 AGCTGGGCCTGCCCCACCTGTGG - Intergenic
1073199778 10:101725990-101726012 TGCTGGGCCCAGCCTAGCCAAGG + Intergenic
1074460945 10:113636269-113636291 AGCTGGCTCTGCCCTCCCCAAGG + Intronic
1076746733 10:132518288-132518310 TGCTGGCCCCGCCCTCCCCTGGG + Intergenic
1076902439 10:133346607-133346629 AGCTGGTCCCGCCCTGCCGCAGG + Intronic
1077192309 11:1260543-1260565 TGCTGGGCCGACCCTCCCCATGG - Intronic
1077507793 11:2940199-2940221 AGCAGGGGCTGCCCTCCCCAAGG - Intergenic
1081993611 11:47350448-47350470 CCCTGGACACGCCCTACCCACGG + Intronic
1082059512 11:47848381-47848403 AGCTCCGCCCGCCCCACCCCCGG - Exonic
1083147670 11:60771228-60771250 AGCAGGGTCTGCCCTGCCCAGGG + Intronic
1083596853 11:63921738-63921760 AGCAGGGCCCCCTCTGCCCATGG + Intergenic
1084128592 11:67117917-67117939 AGCTGCGCCGGCCCTGCCCACGG - Intergenic
1085705934 11:78786881-78786903 ACCTCGGCCCGCCATACCGATGG + Exonic
1085718047 11:78890232-78890254 GGATGGGACAGCCCTACCCATGG + Intronic
1087269114 11:96092953-96092975 ACCTAGGCCCTCCTTACCCATGG - Exonic
1090255557 11:125281257-125281279 AGCTGGGCCTTCTCTACACACGG - Intronic
1091788281 12:3256282-3256304 AGCGGGGCCCGGCCTTTCCAGGG - Intronic
1091896555 12:4109826-4109848 AGCTGGCCCTGGCCTTCCCAAGG - Intergenic
1094244974 12:28279517-28279539 AGCTGGTGCCTCCCTTCCCAGGG - Intronic
1097052256 12:56230589-56230611 GGGTGGCCCCTCCCTACCCAGGG + Intronic
1097622302 12:61954626-61954648 TGCTGTGCCCACCTTACCCATGG - Intronic
1101177076 12:102163959-102163981 AGGTGTGCCCCCCCTACTCAAGG - Intronic
1102073489 12:110041555-110041577 GGCTGGGCCCTCCCCACCCAGGG + Exonic
1102965069 12:117119429-117119451 AGCTGGGCCAGCAGCACCCATGG - Intergenic
1103443683 12:120980564-120980586 GGCTGGGCCTGACCTGCCCAGGG + Intronic
1103658472 12:122494136-122494158 AGCTGGCCCCGGGCTACCCATGG - Intronic
1104638491 12:130452391-130452413 AGCTGGGGCAGCCCTGCCCTGGG + Intronic
1111687349 13:91517756-91517778 ATCTGGGACCTCCCCACCCATGG - Intronic
1113465886 13:110512637-110512659 AGCAGGGCCAGGCCCACCCACGG - Exonic
1113708231 13:112447562-112447584 AGCTGGGCACCTCCTGCCCAGGG - Intergenic
1113941817 13:114022401-114022423 TGCGTGGCCAGCCCTACCCACGG + Intronic
1113957566 13:114107493-114107515 GGCTGGGCTCTTCCTACCCAAGG + Intronic
1118206373 14:63727636-63727658 AGCTGGGCCCGGCCTCGCCGCGG - Exonic
1119554443 14:75542532-75542554 AGCTGGGCGAGCCCTTTCCAGGG + Intronic
1122062150 14:99143219-99143241 AGCTGGGCCAGCCAGACCCAAGG - Intergenic
1122953494 14:105059134-105059156 AGCCGGGCCGGCCCTGCCCTGGG - Intronic
1122971174 14:105152836-105152858 GCCTGGGCCAGCCCTGCCCAGGG + Intronic
1124577613 15:30923646-30923668 AGCTGGGCCCTCCCTCTCCGAGG + Intronic
1125001540 15:34775760-34775782 AACTGAGCCCTCCCTCCCCAAGG + Intergenic
1128550380 15:68594502-68594524 AGCAGGGACCACCCTGCCCAAGG - Intronic
1129296647 15:74603638-74603660 AGCTGGGACAGCCCCATCCAGGG - Intronic
1129756922 15:78104265-78104287 ACCTGAGCCCGCTCTGCCCAGGG - Exonic
1129937549 15:79463338-79463360 AGCTGGGCTTCCCCCACCCAGGG - Intronic
1132186688 15:99806964-99806986 AGCTGGCCCCGCCCCGCCCCCGG + Intergenic
1132428999 15:101745747-101745769 AGCTGGCCCCGCCCCGCCCCCGG - Intergenic
1132678612 16:1130798-1130820 ATCTGCCCCCGGCCTACCCAGGG - Intergenic
1132715254 16:1286874-1286896 AGCTGGGCCTTCCCTGGCCAGGG + Intergenic
1132956986 16:2599534-2599556 AGCTGGGCCGCACCTACCCTGGG + Exonic
1132969337 16:2677987-2678009 AGCTGGGCCGCACCTACCCTGGG + Intergenic
1133234894 16:4383163-4383185 GGCAGGGCCCGCCGTGCCCAGGG - Exonic
1134840430 16:17397470-17397492 CCCTGGGCCCACCCTTCCCATGG + Intronic
1135192081 16:20362632-20362654 AGCTGGCGCCACCCTACACATGG + Intronic
1136428926 16:30186032-30186054 AGCTGGGCCCGCGCCCCACATGG + Intronic
1136515349 16:30764917-30764939 ACCTGGGCCCTGCCTTCCCAGGG + Exonic
1136553824 16:30996655-30996677 AGCAGAGCCCGCCCCACCCGCGG + Intronic
1137832498 16:51557359-51557381 AGCTGGGGCTGCTCCACCCATGG + Intergenic
1140923280 16:79559136-79559158 AGCTAAGCCCGCCCAAACCACGG - Intergenic
1142003841 16:87679830-87679852 AGTTGGTCCCTCCCTGCCCATGG + Intronic
1142140839 16:88472065-88472087 AGCTGGGCTCCCACCACCCATGG + Intronic
1142147703 16:88499464-88499486 AGCTGGGCCGGCCCCACCCCAGG - Intronic
1142230951 16:88900089-88900111 CGCTGGGCCCGCCGTCCCCCAGG + Intronic
1143175710 17:4953751-4953773 AGCTGCTCCCGCCTTACACACGG - Exonic
1144814972 17:18027635-18027657 AGCTGGGCCCTTCCTTCCCCAGG + Intronic
1146736332 17:35242241-35242263 AGCAGCGCGCGCCGTACCCACGG + Intergenic
1146921123 17:36712807-36712829 AGCTGGGGCAGACCTTCCCATGG - Intergenic
1147563455 17:41522580-41522602 AGCAGGGCCATACCTACCCAAGG + Intergenic
1149665564 17:58362802-58362824 AGGTGGGCCCTCCCTGCCCAAGG + Intronic
1150221340 17:63497375-63497397 GGCTGGGTCGGCCCTGCCCAAGG + Intronic
1150710999 17:67530756-67530778 AGATGGGCACACACTACCCAGGG - Intronic
1151579904 17:74972053-74972075 ACCTGGGCCTTCCCTGCCCACGG + Intronic
1152065137 17:78108246-78108268 GGCTGGCCCCCCCCCACCCATGG + Exonic
1152259301 17:79258483-79258505 TGCTGGGCCAGCCCTTCCCACGG + Intronic
1152558233 17:81065254-81065276 GGCTGGGCCCGCCCTCCCTCGGG - Intronic
1160143440 18:76346622-76346644 AGCTGAGCCTGCACTGCCCAAGG + Intergenic
1160237796 18:77099642-77099664 AGCTGGGCCGGGCCTGCCCGAGG - Intronic
1161025302 19:2033988-2034010 GGCTGGGCCCGTCCTGGCCATGG + Intronic
1161479531 19:4503633-4503655 TGCTGGGCCCAGCCTCCCCAGGG + Exonic
1163727156 19:18929311-18929333 AGCCCGGCCCGGCCCACCCAGGG + Exonic
1164970806 19:32530987-32531009 AGCTGAGCCCAGCCAACCCATGG + Intergenic
1166422893 19:42652465-42652487 AGCAGGGTCCGCCCTCACCAGGG + Intronic
1166688622 19:44810083-44810105 ATCTGGCCCAGCCCTACCCCTGG - Intronic
1167045220 19:47045593-47045615 CCCTGGGCCTGCCCTACCCGGGG + Exonic
1167095925 19:47375163-47375185 AGCAGGGCCCCCCAGACCCAAGG + Intronic
1167605538 19:50479892-50479914 AGCTGGGACCGCCCCACCTAGGG - Intronic
1167718335 19:51158952-51158974 AGCAGGGGGCGCCCTAACCATGG + Intergenic
925152156 2:1622453-1622475 AGCAAGGCACGCCCTAACCAGGG + Intergenic
926152456 2:10432659-10432681 AGCTGGGCACGCCCTCTCCTTGG + Intergenic
932336527 2:70934818-70934840 AGCTGGACCTGCCCAACCCAAGG - Intergenic
937915710 2:127097772-127097794 GGCAGGGCCCGCCTCACCCAAGG + Intronic
942306970 2:174618185-174618207 AGCTGGGCTCACCCCAACCATGG + Intronic
944911804 2:204317826-204317848 CGCAGGGCCCGCCAGACCCACGG - Intergenic
945201857 2:207289825-207289847 AGCTGGGCAGGGCTTACCCATGG - Intergenic
947724308 2:232387774-232387796 ATCAGGGCCCTCCCAACCCAGGG - Intergenic
1174068474 20:47883167-47883189 GGCTGGGTCCACCCCACCCATGG + Intergenic
1174950458 20:55036143-55036165 AGCTGAGCCCACCCAAGCCAGGG - Intergenic
1175171569 20:57084922-57084944 AGCTGGCCTCTCCTTACCCAAGG - Intergenic
1175991041 20:62789238-62789260 TGCTGAGCCCGCGCTACCCCAGG - Intergenic
1176001027 20:62831260-62831282 AGCGGGGCACGGCCTACCCAGGG + Intronic
1178244087 21:30935523-30935545 TGCTGCGCCCACCCTGCCCACGG + Intergenic
1178684820 21:34702597-34702619 CGCTGCGCCTGCCCTGCCCATGG - Intronic
1179842438 21:44086127-44086149 AGCAGGCCCTGCCCTCCCCATGG + Intronic
1181366156 22:22378575-22378597 AGCTGGGCCTGGGCCACCCAAGG - Intergenic
1182477077 22:30582188-30582210 CGCTGGGCCTGGCCTTCCCAAGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183639394 22:39083911-39083933 GGCAGGGCCCTCCCAACCCAGGG + Intronic
1185223990 22:49642893-49642915 AGCTGGCCGCGCCCCTCCCACGG + Intronic
1185342731 22:50298996-50299018 AGCTGGGCCTGCCCTCCCACTGG - Intronic
1185346296 22:50312274-50312296 AGCTGCGCCTGCCCTGACCATGG - Intronic
952759969 3:36904999-36905021 CACTGTGCCCGGCCTACCCAGGG - Intronic
955387747 3:58492468-58492490 AGCATCGCCCGCCCTACCCCTGG + Intronic
960732580 3:120742966-120742988 AGCCAAGCCCGCCCTACCCGAGG - Intronic
968513334 4:1004746-1004768 AGCTCGGCCCTGCCCACCCAGGG + Intergenic
968522059 4:1038493-1038515 AGCTTGACCCGCCCTCCCCGGGG + Intergenic
969540273 4:7784336-7784358 AGCGGGCCCTGCCCTGCCCAGGG + Intronic
972333217 4:38082264-38082286 AGCTGGGCCTTGCCTCCCCAGGG - Intronic
976822990 4:89228095-89228117 AACTGGGCCCGCCTTACCTTTGG + Intergenic
989515712 5:42340109-42340131 TTCTGGGCCAGCCCTGCCCATGG + Intergenic
991577466 5:68120065-68120087 AGCTGGGCTTGCCTTACTCAAGG - Intergenic
998445876 5:142198031-142198053 TGCTGGGCCTGCCTTTCCCACGG + Intergenic
998931900 5:147190569-147190591 AGCTGGGCCCTCCCTCCACATGG + Intergenic
999948809 5:156626378-156626400 AGCTGGGCCATACTTACCCATGG - Intronic
1000398025 5:160796598-160796620 AGCTGGTCGCGCCCTTCCAAAGG + Intronic
1002381438 5:178832297-178832319 ATCTGGGCCTGCACTGCCCAAGG - Intergenic
1008034632 6:46733483-46733505 AACTGGGCCCTTCATACCCAAGG - Intronic
1011433555 6:87314257-87314279 ACCTTAGCCCTCCCTACCCAAGG + Intronic
1017002548 6:150006105-150006127 AGCTGAGCCCACTCTACCCCCGG + Intergenic
1018079058 6:160243275-160243297 ACCTGGGCCTGCTTTACCCAAGG + Intronic
1019275460 7:173315-173337 GGCTGGGCCAGCCCACCCCAGGG + Intergenic
1019428601 7:988463-988485 AGCTGGGGCCGTCCCACCCCTGG - Intronic
1019442543 7:1054744-1054766 AGCTGAGCCGGCCCCACACACGG - Intronic
1020142742 7:5621538-5621560 AGCAGGGCCTGGCCCACCCAAGG - Intronic
1025814975 7:64903042-64903064 AACTGAGCCCGGCCCACCCACGG - Intronic
1025855121 7:65269653-65269675 AGCTGGGCCCTCAGTACCCCCGG + Intergenic
1026737890 7:72960435-72960457 AGCTGGGGCCACCCTCCCCACGG - Intronic
1026788924 7:73319236-73319258 AGCTGGGGTCACCCTCCCCACGG - Intronic
1026909241 7:74083153-74083175 AGCTGGGGCTGCCCTGCCCAGGG - Intronic
1027105844 7:75404633-75404655 AGCTGGGGCCACCCTCCCCACGG + Intronic
1029652191 7:101901189-101901211 AGCTGGGCCCGCCCTACCCAGGG - Intronic
1035314578 7:157990181-157990203 ATCTGGGCCCGCTCTGCCCTGGG - Intronic
1037887843 8:22604495-22604517 AGCTGGGCCCCCCAAACACAAGG - Intergenic
1039495327 8:37975922-37975944 GGCTGGGAGCTCCCTACCCAGGG - Intergenic
1042721859 8:71834666-71834688 AACTGGGCCACCCCTACACAGGG + Intronic
1042885705 8:73547848-73547870 AGTTGGGCCCTCCATATCCATGG + Intronic
1046592717 8:116225400-116225422 AGCTGGGGCTGCCCTTCCAAAGG + Intergenic
1048484328 8:134832622-134832644 AGCCGAGCCCGCCCCGCCCACGG - Intergenic
1049056449 8:140240965-140240987 ACCTGGGCCTGCCATTCCCACGG + Intronic
1049573146 8:143378845-143378867 AGCTGGGCCTCCCCTCCCCAGGG - Intronic
1049687796 8:143945895-143945917 GCCTGGGCCCGCCCGACCCCTGG - Intronic
1049789829 8:144467463-144467485 AACTGGGCCCACCCTACTCCAGG + Exonic
1049798221 8:144506059-144506081 AGATGGGGCCGCCCTACGCCGGG + Exonic
1054920314 9:70536786-70536808 AGCTTGGCTCGCCCAGCCCAAGG + Exonic
1060038981 9:120283555-120283577 AGCTGGGCCCTCCTGACCCTGGG + Intergenic
1060509607 9:124222367-124222389 TGCTGGGCCTGCCCTATCCCAGG + Intergenic
1060974159 9:127754937-127754959 GGCTGGGCCCGGCCGACCCGGGG - Intronic
1061240525 9:129368599-129368621 GGCTGGGCCCACACTTCCCATGG + Intergenic
1061391184 9:130318047-130318069 CCTTGGGCCCGCCCTACACAAGG - Intronic
1061548663 9:131319723-131319745 AGCTGGCCCCTCCCCACCAAGGG - Intergenic
1061733664 9:132637139-132637161 CTCTGCCCCCGCCCTACCCAGGG + Intronic
1061754694 9:132804371-132804393 ATCTGGGACCTCCCTACCCCAGG - Intronic
1061834636 9:133320740-133320762 GCCTGGGCCTGCCATACCCAGGG - Intergenic
1062483736 9:136764050-136764072 AGCAGGGCCCTCCTTGCCCAGGG + Intronic
1062515033 9:136928773-136928795 GGCTGGGCCAGGCCTGCCCACGG - Intronic
1062548082 9:137072685-137072707 AGCTGGGGCCGCCTCCCCCAAGG - Intergenic
1185472182 X:390622-390644 AGCTGGGTCAGCGCTTCCCAGGG + Intergenic
1188154388 X:26722958-26722980 AGATGGGCCCACCCCACCCATGG + Intergenic
1188538054 X:31219264-31219286 AGCTGTTCCCTCCCTACCCCAGG + Intronic
1190753311 X:53380603-53380625 AGCCAGGCCCGCCCTACCTCAGG + Exonic
1192562915 X:72139309-72139331 AGGTGGGTCAGCACTACCCAAGG + Exonic
1198302138 X:135343573-135343595 TGCTGCTCCCGCCCGACCCAAGG - Exonic