ID: 1029652524

View in Genome Browser
Species Human (GRCh38)
Location 7:101903239-101903261
Sequence TACACAAGGCGGGTGGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029652511_1029652524 23 Left 1029652511 7:101903193-101903215 CCCCATCCTGGTATGGGGGAACA 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG 0: 1
1: 0
2: 1
3: 18
4: 126
1029652513_1029652524 21 Left 1029652513 7:101903195-101903217 CCATCCTGGTATGGGGGAACACA 0: 1
1: 0
2: 1
3: 16
4: 156
Right 1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG 0: 1
1: 0
2: 1
3: 18
4: 126
1029652508_1029652524 27 Left 1029652508 7:101903189-101903211 CCCTCCCCATCCTGGTATGGGGG 0: 1
1: 0
2: 1
3: 15
4: 190
Right 1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG 0: 1
1: 0
2: 1
3: 18
4: 126
1029652515_1029652524 17 Left 1029652515 7:101903199-101903221 CCTGGTATGGGGGAACACAGGAG 0: 1
1: 0
2: 1
3: 17
4: 266
Right 1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG 0: 1
1: 0
2: 1
3: 18
4: 126
1029652506_1029652524 28 Left 1029652506 7:101903188-101903210 CCCCTCCCCATCCTGGTATGGGG 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG 0: 1
1: 0
2: 1
3: 18
4: 126
1029652512_1029652524 22 Left 1029652512 7:101903194-101903216 CCCATCCTGGTATGGGGGAACAC 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG 0: 1
1: 0
2: 1
3: 18
4: 126
1029652510_1029652524 26 Left 1029652510 7:101903190-101903212 CCTCCCCATCCTGGTATGGGGGA 0: 1
1: 0
2: 0
3: 22
4: 180
Right 1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG 0: 1
1: 0
2: 1
3: 18
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029652524 Original CRISPR TACACAAGGCGGGTGGTGGC GGG Intronic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
900944111 1:5820046-5820068 TACACAAGGTGTGTGGAGACAGG + Intergenic
901427200 1:9189872-9189894 AACACAAAGAGGGTGGGGGCTGG - Intergenic
901528839 1:9841292-9841314 AACAAAAGGAGGCTGGTGGCTGG + Intergenic
902984414 1:20146853-20146875 TACCCCTGGTGGGTGGTGGCTGG - Intronic
903275049 1:22216267-22216289 TAGACCAGGCGGGTGGAGGCGGG + Intergenic
903291406 1:22316488-22316510 TACAGAAGGCTGGTGGTGGCGGG - Intergenic
903681332 1:25099230-25099252 TACACAAGGCGAGGGGAAGCAGG + Intergenic
914649915 1:149689638-149689660 TAAACATGGCGGGTGGGGGATGG - Intergenic
917141771 1:171842017-171842039 GCCACCAGGCGGGGGGTGGCAGG - Intronic
920255740 1:204652890-204652912 TACAGATGGAGGGTGCTGGCAGG + Intronic
922214246 1:223507942-223507964 TACCCAAGGCCCCTGGTGGCTGG - Intergenic
922292624 1:224221138-224221160 TACTTAGGGGGGGTGGTGGCTGG - Intergenic
1065925480 10:30431530-30431552 CACACAAGGCGGGTGGGGAGGGG + Intergenic
1066780843 10:38943074-38943096 AAAAGAAGGAGGGTGGTGGCGGG + Intergenic
1075394192 10:122114626-122114648 TGCACAAGGAGGGTGGCTGCTGG - Intronic
1080019586 11:27546036-27546058 TACACCAGGGGGCTGGTGGGTGG + Intergenic
1080588325 11:33700491-33700513 GACCCAGGCCGGGTGGTGGCGGG + Exonic
1088671628 11:112146849-112146871 TAAAAAGGGCGGGGGGTGGCTGG - Intronic
1089362479 11:117900247-117900269 TTCACAAAGCAGGTGGGGGCAGG - Intergenic
1089411591 11:118247619-118247641 TAAACAAGGCGGGTGTGGGGTGG - Intronic
1089570178 11:119402624-119402646 TACACCACGCAGATGGTGGCAGG - Intergenic
1090258361 11:125301734-125301756 GGCACAAGGCAGGTGGTGCCAGG + Intronic
1090396642 11:126423779-126423801 TACACAAAGCAGGAGGTGGGTGG + Exonic
1094081086 12:26536691-26536713 TACACCAGGCCAGTGTTGGCAGG + Intronic
1101886650 12:108669684-108669706 AAAAAAAGGCGGGGGGTGGCGGG + Intronic
1102338887 12:112106471-112106493 TATACAAGGTGGGTGATGGAAGG - Intronic
1102472219 12:113165770-113165792 TCTACAAGGCAGGGGGTGGCAGG - Intronic
1104708641 12:130968806-130968828 TAAACAAGGGTGGTGGAGGCTGG + Intronic
1111993694 13:95141542-95141564 TACACAAGGTGGGGGGTGGGGGG + Intronic
1118372551 14:65149873-65149895 CATACAAAGCAGGTGGTGGCTGG - Intergenic
1119085892 14:71738580-71738602 TACACAAGGAGTGGGGAGGCCGG - Intronic
1119806676 14:77486712-77486734 TACCCTAGCCTGGTGGTGGCTGG + Intronic
1121087076 14:91154914-91154936 GACACAAGGCAGGAGGTGGCGGG - Intronic
1121433531 14:93903829-93903851 AACACAGGGCGGGTGATGGGTGG - Intergenic
1122797071 14:104211322-104211344 GACAAATGGAGGGTGGTGGCTGG + Intergenic
1122981229 14:105193179-105193201 TCCACAAGGCGGGTGCCGGCAGG - Intergenic
1126134249 15:45375761-45375783 TAAACAATGCGGGGGGTGGTGGG + Intronic
1127237083 15:57065628-57065650 CACTCAAGGGGGGTGGTGGGGGG - Intronic
1129599912 15:76992717-76992739 TACACAACGGGGCTGGAGGCAGG - Intergenic
1131261051 15:90887978-90888000 TACACGAGGCTGGAGGAGGCAGG + Intronic
1133872564 16:9702821-9702843 CTAACAAAGCGGGTGGTGGCAGG + Intergenic
1133917280 16:10120592-10120614 TATACAAGGGGGGTGGATGCAGG + Intronic
1135693697 16:24567323-24567345 TATACCCAGCGGGTGGTGGCTGG - Exonic
1136504646 16:30695160-30695182 TCCACAAGGCTGATGGTTGCCGG - Intergenic
1140435773 16:74945612-74945634 TACCTAAAGCAGGTGGTGGCGGG + Intronic
1141344679 16:83233878-83233900 TATACAAGGAGTGTGGTGGTAGG - Intronic
1141900781 16:86988896-86988918 CACACAGGGCAGGTGGTGGAGGG + Intergenic
1142364861 16:89644859-89644881 TAGAAAAGGCAGGTGGTGGGCGG - Exonic
1145892487 17:28426917-28426939 TAAGCATGGCAGGTGGTGGCTGG - Intergenic
1147505481 17:41012527-41012549 TACAGAAGGTGGCAGGTGGCAGG + Intronic
1147505491 17:41012589-41012611 TACAGAAGGTGGCAGGTGGCAGG + Intronic
1147505503 17:41012658-41012680 TACAGAAGGTGGCAGGTGGCAGG + Intronic
1147505513 17:41012720-41012742 TACAGAAGGTGGCAGGTGGCAGG + Intronic
1147637962 17:41975378-41975400 TACAGAAGGTGGGGGTTGGCTGG + Exonic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1151162382 17:72176331-72176353 TACACAAGGCCGGGGGAGGGGGG - Intergenic
1152073105 17:78143848-78143870 TCCCCAAGGCTGGGGGTGGCTGG - Intergenic
1152509260 17:80774194-80774216 AACTCAAGGCGGGTGGAGACGGG - Intronic
1157545044 18:48540803-48540825 TAGACAAGGAGGGGGCTGGCGGG - Intronic
1160416643 18:78716708-78716730 TGAACAAGGCGGGGAGTGGCGGG + Intergenic
1162298302 19:9828303-9828325 TACACAAAGCGGGGGGTGGGTGG - Intronic
1164218069 19:23168527-23168549 AACACAAGGCAAGTGGAGGCAGG - Intergenic
1164580284 19:29430529-29430551 TACTCATGGCGGGAGGTGGAGGG - Intergenic
1164617765 19:29677019-29677041 TAGAGGAGGCTGGTGGTGGCCGG - Intergenic
1165521255 19:36315961-36315983 TACTCAAGATGGGTGGTGCCGGG + Intergenic
1166109701 19:40614452-40614474 TAGCGAAGGCGGGTGGGGGCAGG - Intronic
1167454438 19:49591184-49591206 TGCACAAGGCGGCTGGGGGAGGG - Intergenic
1168344809 19:55644978-55645000 TTCACCTGGCGGGTGGTGGGCGG + Exonic
1168649688 19:58085362-58085384 TCCAGAAGGCGGGAGGCGGCAGG - Exonic
926056933 2:9779208-9779230 AAGAGAAGGCGGGTGGTGGCCGG - Intergenic
928118112 2:28562723-28562745 GCTACAAGGCGAGTGGTGGCAGG - Intronic
930395404 2:50817110-50817132 GACAGAAGGCGGGTGGAGGAAGG + Intronic
936097011 2:109538136-109538158 TCCACAAGCCAGGTAGTGGCTGG - Intergenic
938647076 2:133342642-133342664 TACACAGTGCAGATGGTGGCTGG - Intronic
938693790 2:133816236-133816258 TGCACTAGGTGGGTGGTGACAGG - Intergenic
939808502 2:146804333-146804355 TACACAAGGGTGGCAGTGGCAGG + Intergenic
948513913 2:238490991-238491013 TACACAAGCCAGCTGGTGGCTGG + Intergenic
1169382343 20:5119346-5119368 GTCACAAAGCGGGTGGTGGCGGG - Intronic
1171426077 20:25049557-25049579 CACACAAGGCCGGTGGCGGCAGG + Intronic
1172506448 20:35466388-35466410 TAGACTAGGCGGGTAGTGGCAGG - Intronic
1172867415 20:38110984-38111006 CACACAAGGCTGCAGGTGGCAGG - Intronic
1173925725 20:46779873-46779895 TAAGCAAGGCGGGGGGTGGGTGG - Intergenic
1174461992 20:50689787-50689809 TCCCCAAGGTGGGTGGTGGGGGG + Intronic
1175231786 20:57478116-57478138 TACAAATGGGAGGTGGTGGCTGG + Intergenic
1175486454 20:59350269-59350291 CACAGAAGCCGGGTGGTGGCGGG + Intergenic
1179656110 21:42845834-42845856 TCCAGAAGACGGGTGCTGGCCGG + Intronic
1181309435 22:21936595-21936617 TACACAAGGCGGGAGGCGCAGGG - Intronic
1183032275 22:35115168-35115190 TAGAAAAGGAAGGTGGTGGCTGG + Intergenic
950618293 3:14180096-14180118 TACACAAGGCCAGTGGAGGAAGG - Intronic
950660915 3:14466621-14466643 TCCTCAAGGCGGGTGATGTCAGG - Exonic
953993323 3:47500575-47500597 TACAAAAAGAGGGTGGTAGCAGG + Intronic
960048021 3:113215550-113215572 TCAACAAGTCTGGTGGTGGCAGG - Intronic
961705717 3:128783497-128783519 GAGACAAGCCGTGTGGTGGCTGG + Intronic
962483205 3:135815768-135815790 TACACCAGGCGGCTGCTGCCAGG - Intergenic
963825978 3:149953807-149953829 TTCACAAGGTGTGTGGTGGGAGG + Intronic
966641368 3:182194487-182194509 TAAACAAAGGTGGTGGTGGCAGG - Intergenic
968887052 4:3340697-3340719 TACAGAAGGCAGGAGCTGGCGGG + Intronic
969237553 4:5876736-5876758 TTCAGAAGGGGGGTGGTGGGGGG - Intronic
973246199 4:48013839-48013861 TAGACAAGAGGGGTGGTAGCTGG - Intronic
974593688 4:63988809-63988831 TCCACATGGCTGGTGGTGGGGGG - Intergenic
977980536 4:103315813-103315835 GACACAAAGTGGGTGGTGGTGGG - Intergenic
984002848 4:174271635-174271657 AATATAAGGAGGGTGGTGGCAGG - Intronic
985618283 5:937678-937700 TAAGCATGGCGGGCGGTGGCAGG + Intergenic
985843518 5:2327309-2327331 ACCACAAGGCGGGTGGAGGGTGG + Intergenic
989069403 5:37494930-37494952 TACAAAAACAGGGTGGTGGCTGG - Intronic
996843641 5:127875926-127875948 TGCACAAGCTGGGTGGTAGCAGG + Intergenic
1001220703 5:169898089-169898111 CACACAAGAAGGTTGGTGGCAGG - Intronic
1003160217 6:3627979-3628001 TCCAAAAGGCGGGAGGTGACAGG + Intergenic
1009965213 6:70570593-70570615 TAGACAGGGAGGGTGGTGGGGGG - Intronic
1011188590 6:84706306-84706328 TACAAAAGACAGGTGGAGGCTGG + Intronic
1014187974 6:118457588-118457610 AACAGAAGGCGGGTGGGGGTGGG - Intergenic
1016040790 6:139429968-139429990 TACACAAGGAGTGTGGTGGTGGG + Intergenic
1017853452 6:158327027-158327049 TACACAAGGGGGATGGTTGCAGG - Intronic
1019564541 7:1672910-1672932 TACACGAGGGGGCCGGTGGCGGG + Intergenic
1021664559 7:22962782-22962804 TGCACTAGCCTGGTGGTGGCTGG - Intronic
1021961938 7:25881654-25881676 TACACAAGGCGGCTGAAGGAGGG + Intergenic
1025809473 7:64866288-64866310 TACCCAAGGCAGGTGGTGGTAGG - Intergenic
1026731397 7:72914711-72914733 TGCACAAAGCAGGTGGTGGTAGG + Intronic
1027624091 7:80526993-80527015 TACACGAGGAAGGTGGAGGCTGG + Intronic
1028385123 7:90245409-90245431 TCCACATGGCCGGTGGCGGCGGG - Exonic
1029424259 7:100486609-100486631 AACACAAGGCAGTTGGGGGCAGG - Intronic
1029652524 7:101903239-101903261 TACACAAGGCGGGTGGTGGCGGG + Intronic
1030067075 7:105667975-105667997 TACTCAAAGCTGGTGGTGGGTGG + Intronic
1032000906 7:128264845-128264867 TCCTCAAAGGGGGTGGTGGCTGG + Intergenic
1033824094 7:145168635-145168657 TGAACGAGGCGGGTGGTGGGAGG - Intergenic
1037797149 8:22005391-22005413 TATACAAGGCAGGTTGTGGCAGG - Exonic
1041714670 8:60922741-60922763 CACACAAGGGGGGTGGCGGGAGG + Intergenic
1043645727 8:82516249-82516271 TACACAAAGTGGGTGTTGTCAGG + Intergenic
1046609008 8:116403603-116403625 TACATAAGGGGGCTGGGGGCTGG - Intergenic
1046650593 8:116833029-116833051 TGCACAGGGCGGGTGGAGGGTGG + Intronic
1047091779 8:121583285-121583307 TACACAAGGCCTGTGGAAGCTGG + Intergenic
1048580227 8:135724416-135724438 TACACCAGGCGTGGTGTGGCTGG - Intergenic
1049046507 8:140156179-140156201 TACACGAAGCAGGTGGTGGCGGG - Intronic
1051585352 9:18721447-18721469 TAGACAAGGCAGCTGGTGGGAGG - Intronic
1060247148 9:121956672-121956694 GACACAAGGCCGGGGGTGGCAGG + Intronic
1061059913 9:128245104-128245126 AGCACAGGGCGGGTGGTGGCGGG + Intronic
1061108700 9:128552207-128552229 TCCGCAGGGCGGGCGGTGGCGGG + Intergenic
1061929523 9:133825229-133825251 TTCTTAAGGCGGGTGATGGCCGG - Intronic
1186182234 X:6984622-6984644 TGTACCAGGAGGGTGGTGGCTGG - Intergenic
1186535295 X:10340980-10341002 TACACAAGGCAGGGCGTGGGGGG - Intergenic
1189334965 X:40165462-40165484 TGCACAGGGCTGGTTGTGGCTGG - Intronic
1189734735 X:44058437-44058459 TAGACAAGGCCCTTGGTGGCAGG + Intergenic
1194539938 X:95157291-95157313 GACCCAAGCCTGGTGGTGGCGGG - Intergenic
1196238081 X:113306302-113306324 ATCACAAGGCAGGTGGAGGCAGG + Intergenic
1199444077 X:147900816-147900838 CACATAAGTCTGGTGGTGGCTGG + Intergenic