ID: 1029656775

View in Genome Browser
Species Human (GRCh38)
Location 7:101930866-101930888
Sequence GCGGACGGGTCACTTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029656770_1029656775 -2 Left 1029656770 7:101930845-101930867 CCAGCACTTTGGGAGGCTGAGGC 0: 56931
1: 168651
2: 218048
3: 269456
4: 306914
Right 1029656775 7:101930866-101930888 GCGGACGGGTCACTTGAGGCTGG No data
1029656766_1029656775 7 Left 1029656766 7:101930836-101930858 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1029656775 7:101930866-101930888 GCGGACGGGTCACTTGAGGCTGG No data
1029656768_1029656775 -1 Left 1029656768 7:101930844-101930866 CCCAGCACTTTGGGAGGCTGAGG 0: 90349
1: 212695
2: 235979
3: 260133
4: 296590
Right 1029656775 7:101930866-101930888 GCGGACGGGTCACTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029656775 Original CRISPR GCGGACGGGTCACTTGAGGC TGG Intronic