ID: 1029658347

View in Genome Browser
Species Human (GRCh38)
Location 7:101942550-101942572
Sequence GAGGATCGCTGAAGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77959
Summary {0: 3, 1: 201, 2: 3029, 3: 16992, 4: 57734}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029658347_1029658357 30 Left 1029658347 7:101942550-101942572 CCTCCTGGGCTTCAGCGATCCTC 0: 3
1: 201
2: 3029
3: 16992
4: 57734
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029658347 Original CRISPR GAGGATCGCTGAAGCCCAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr