ID: 1029658348

View in Genome Browser
Species Human (GRCh38)
Location 7:101942553-101942575
Sequence TGGGAGGATCGCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102195
Summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029658348_1029658357 27 Left 1029658348 7:101942553-101942575 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029658348 Original CRISPR TGGGAGGATCGCTGAAGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr