ID: 1029658349

View in Genome Browser
Species Human (GRCh38)
Location 7:101942569-101942591
Sequence GCTAGGGAGGCTGAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216480
Summary {0: 48, 1: 1467, 2: 16083, 3: 64386, 4: 134496}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029658349_1029658357 11 Left 1029658349 7:101942569-101942591 CCTCCCACCTCAGCCTCCCTAGC 0: 48
1: 1467
2: 16083
3: 64386
4: 134496
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029658349 Original CRISPR GCTAGGGAGGCTGAGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr