ID: 1029658350

View in Genome Browser
Species Human (GRCh38)
Location 7:101942572-101942594
Sequence GCTGCTAGGGAGGCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570379
Summary {0: 62, 1: 2352, 2: 36664, 3: 233514, 4: 297787}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029658350_1029658357 8 Left 1029658350 7:101942572-101942594 CCCACCTCAGCCTCCCTAGCAGC 0: 62
1: 2352
2: 36664
3: 233514
4: 297787
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029658350 Original CRISPR GCTGCTAGGGAGGCTGAGGT GGG (reversed) Intronic
Too many off-targets to display for this crispr