ID: 1029658351

View in Genome Browser
Species Human (GRCh38)
Location 7:101942573-101942595
Sequence AGCTGCTAGGGAGGCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191777
Summary {0: 69, 1: 2081, 2: 24309, 3: 48457, 4: 116861}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029658351_1029658357 7 Left 1029658351 7:101942573-101942595 CCACCTCAGCCTCCCTAGCAGCT 0: 69
1: 2081
2: 24309
3: 48457
4: 116861
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029658351 Original CRISPR AGCTGCTAGGGAGGCTGAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr