ID: 1029658352

View in Genome Browser
Species Human (GRCh38)
Location 7:101942576-101942598
Sequence CTCAGCTGCTAGGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551523
Summary {0: 27, 1: 1272, 2: 27063, 3: 235112, 4: 288049}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029658352_1029658357 4 Left 1029658352 7:101942576-101942598 CCTCAGCCTCCCTAGCAGCTGAG 0: 27
1: 1272
2: 27063
3: 235112
4: 288049
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029658352 Original CRISPR CTCAGCTGCTAGGGAGGCTG AGG (reversed) Intronic
Too many off-targets to display for this crispr