ID: 1029658354

View in Genome Browser
Species Human (GRCh38)
Location 7:101942585-101942607
Sequence ATCTGTGGTCTCAGCTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23167
Summary {0: 1, 1: 7, 2: 206, 3: 2459, 4: 20494}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029658354_1029658363 24 Left 1029658354 7:101942585-101942607 CCCTAGCAGCTGAGACCACAGAT 0: 1
1: 7
2: 206
3: 2459
4: 20494
Right 1029658363 7:101942632-101942654 TTTAAATTATTTGTAGAGACAGG 0: 37
1: 858
2: 4040
3: 25704
4: 231366
1029658354_1029658364 25 Left 1029658354 7:101942585-101942607 CCCTAGCAGCTGAGACCACAGAT 0: 1
1: 7
2: 206
3: 2459
4: 20494
Right 1029658364 7:101942633-101942655 TTAAATTATTTGTAGAGACAGGG 0: 37
1: 718
2: 3003
3: 16493
4: 107243
1029658354_1029658357 -5 Left 1029658354 7:101942585-101942607 CCCTAGCAGCTGAGACCACAGAT 0: 1
1: 7
2: 206
3: 2459
4: 20494
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029658354 Original CRISPR ATCTGTGGTCTCAGCTGCTA GGG (reversed) Intronic
Too many off-targets to display for this crispr