ID: 1029658355

View in Genome Browser
Species Human (GRCh38)
Location 7:101942586-101942608
Sequence CATCTGTGGTCTCAGCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61239
Summary {0: 2, 1: 79, 2: 1029, 3: 9129, 4: 51000}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029658355_1029658364 24 Left 1029658355 7:101942586-101942608 CCTAGCAGCTGAGACCACAGATG 0: 2
1: 79
2: 1029
3: 9129
4: 51000
Right 1029658364 7:101942633-101942655 TTAAATTATTTGTAGAGACAGGG 0: 37
1: 718
2: 3003
3: 16493
4: 107243
1029658355_1029658357 -6 Left 1029658355 7:101942586-101942608 CCTAGCAGCTGAGACCACAGATG 0: 2
1: 79
2: 1029
3: 9129
4: 51000
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031
1029658355_1029658363 23 Left 1029658355 7:101942586-101942608 CCTAGCAGCTGAGACCACAGATG 0: 2
1: 79
2: 1029
3: 9129
4: 51000
Right 1029658363 7:101942632-101942654 TTTAAATTATTTGTAGAGACAGG 0: 37
1: 858
2: 4040
3: 25704
4: 231366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029658355 Original CRISPR CATCTGTGGTCTCAGCTGCT AGG (reversed) Intronic
Too many off-targets to display for this crispr