ID: 1029658357

View in Genome Browser
Species Human (GRCh38)
Location 7:101942603-101942625
Sequence CAGATGCCTGCCACCACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125768
Summary {0: 97, 1: 2191, 2: 11870, 3: 35579, 4: 76031}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029658351_1029658357 7 Left 1029658351 7:101942573-101942595 CCACCTCAGCCTCCCTAGCAGCT 0: 69
1: 2081
2: 24309
3: 48457
4: 116861
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031
1029658347_1029658357 30 Left 1029658347 7:101942550-101942572 CCTCCTGGGCTTCAGCGATCCTC 0: 3
1: 201
2: 3029
3: 16992
4: 57734
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031
1029658348_1029658357 27 Left 1029658348 7:101942553-101942575 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031
1029658349_1029658357 11 Left 1029658349 7:101942569-101942591 CCTCCCACCTCAGCCTCCCTAGC 0: 48
1: 1467
2: 16083
3: 64386
4: 134496
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031
1029658354_1029658357 -5 Left 1029658354 7:101942585-101942607 CCCTAGCAGCTGAGACCACAGAT 0: 1
1: 7
2: 206
3: 2459
4: 20494
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031
1029658353_1029658357 -2 Left 1029658353 7:101942582-101942604 CCTCCCTAGCAGCTGAGACCACA 0: 4
1: 86
2: 2128
3: 23796
4: 151767
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031
1029658355_1029658357 -6 Left 1029658355 7:101942586-101942608 CCTAGCAGCTGAGACCACAGATG 0: 2
1: 79
2: 1029
3: 9129
4: 51000
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031
1029658350_1029658357 8 Left 1029658350 7:101942572-101942594 CCCACCTCAGCCTCCCTAGCAGC 0: 62
1: 2352
2: 36664
3: 233514
4: 297787
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031
1029658352_1029658357 4 Left 1029658352 7:101942576-101942598 CCTCAGCCTCCCTAGCAGCTGAG 0: 27
1: 1272
2: 27063
3: 235112
4: 288049
Right 1029658357 7:101942603-101942625 CAGATGCCTGCCACCACACCCGG 0: 97
1: 2191
2: 11870
3: 35579
4: 76031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029658357 Original CRISPR CAGATGCCTGCCACCACACC CGG Intronic
Too many off-targets to display for this crispr