ID: 1029660699

View in Genome Browser
Species Human (GRCh38)
Location 7:101959219-101959241
Sequence CACTGCACACACATAGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029660699_1029660700 24 Left 1029660699 7:101959219-101959241 CCTAGCTCTATGTGTGTGCAGTG 0: 1
1: 0
2: 1
3: 14
4: 148
Right 1029660700 7:101959266-101959288 TGTGTGTGTGCAAGAGAGCGTGG 0: 1
1: 3
2: 26
3: 251
4: 1066

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029660699 Original CRISPR CACTGCACACACATAGAGCT AGG (reversed) Intronic
900608086 1:3532673-3532695 CACTGCAGAGACAGAAAGCTTGG + Intronic
900656647 1:3762020-3762042 CTCTGCCCACACCTAGAGGTGGG - Intronic
900865706 1:5267333-5267355 AACTGCAAATAAATAGAGCTGGG + Intergenic
901098624 1:6702173-6702195 CACTGCACACACACCAGGCTGGG - Intergenic
902652364 1:17845022-17845044 CATTCCACATACAAAGAGCTGGG - Intergenic
904048635 1:27624766-27624788 CACTGCTCCCACACAGAGATAGG - Intronic
904296928 1:29525713-29525735 AACAGCAGACACATAGAGCGTGG + Intergenic
904861401 1:33540781-33540803 CCCTGCACCCACCTAGAGCCTGG + Intronic
905215251 1:36401939-36401961 CAGTGCACGCACATCAAGCTGGG + Intergenic
906033591 1:42737969-42737991 CACTGCACCCAGCCAGAGCTGGG + Intronic
907606601 1:55824070-55824092 CACAGCACAAAGATAGAGGTAGG - Intergenic
911519470 1:98911141-98911163 CCCTGCACTCACACAGAGCATGG - Intronic
914860773 1:151384074-151384096 CACAGCAAACACATAGATCTAGG + Intergenic
914960652 1:152203731-152203753 CCCTTCACACACATATAGTTTGG + Intergenic
916338330 1:163698441-163698463 CAGAGCACACAGAAAGAGCTTGG - Intergenic
917458442 1:175205848-175205870 CACTCCACACATCTGGAGCTAGG - Intergenic
917592820 1:176494732-176494754 CTCTGCACACACTGGGAGCTGGG + Intronic
918911599 1:190579471-190579493 CACTCCACACATCTATAGCTTGG - Intergenic
921887186 1:220318761-220318783 AACTTCACATACATACAGCTCGG + Intergenic
922315932 1:224442092-224442114 CACTGCACCCACCTTGAGGTGGG + Intronic
923278213 1:232416721-232416743 CAAAGCACACACATAGTGGTTGG + Intronic
923349176 1:233086939-233086961 CTCTGCCCACACATAGCTCTAGG - Intronic
924358078 1:243205251-243205273 CAGTGCCCACACATAGGGCCAGG + Intronic
1063797272 10:9526429-9526451 CACTGCACTCTCTTTGAGCTAGG + Intergenic
1066142902 10:32526020-32526042 CTCTGAACACACTTAGGGCTTGG - Intronic
1066349761 10:34626352-34626374 CACTTCACACACAGAGAGGAGGG - Intronic
1067055111 10:43045558-43045580 CCCTGCACATGGATAGAGCTGGG - Intergenic
1068044698 10:51871464-51871486 CACTGCACACAGCAAGAGCCTGG + Intronic
1068904628 10:62309255-62309277 AACTGGACACATATAGAGATAGG - Intergenic
1068934910 10:62626053-62626075 CACTGCAGACATATAGAGGGGGG - Intronic
1070352395 10:75605763-75605785 AACTGCTCACACAAAGAACTTGG - Intronic
1071437127 10:85657794-85657816 CACTGCACCCACAAAGAACCTGG - Intronic
1072625493 10:97108473-97108495 CACTGCAGACACACGGAGCCTGG - Intronic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1074676816 10:115860590-115860612 AACTGCAGAAACACAGAGCTAGG + Intronic
1074757519 10:116635945-116635967 CACTGAACACTCACAGACCTTGG - Intronic
1078135499 11:8648642-8648664 CACTGCAGAAATACAGAGCTCGG + Intronic
1084942321 11:72619531-72619553 CAGTGCACACACATAGACACAGG - Intronic
1085298710 11:75445799-75445821 CACTTCCCAGACACAGAGCTGGG + Intronic
1088843187 11:113643799-113643821 CACAGCACACACATACAGTGGGG - Intergenic
1090602541 11:128388258-128388280 CAATGTACACAAATACAGCTGGG - Intergenic
1091896568 12:4109910-4109932 CAATGCACACACCTTGAGTTTGG + Intergenic
1093676476 12:21946166-21946188 CTCTGCACACACATGCACCTCGG + Intergenic
1094198811 12:27777546-27777568 CACTGCACCCTCATAGAGAATGG + Intergenic
1097590455 12:61567935-61567957 CTGTGCACACACAGAGAACTTGG + Intergenic
1101569579 12:105940788-105940810 CACTGCAGGCACTAAGAGCTTGG - Intergenic
1101822961 12:108197902-108197924 CACTGCATATACAGAGATCTTGG - Intronic
1102503971 12:113372367-113372389 AACTGAACACACATATAGATTGG + Intronic
1102593720 12:113976497-113976519 CACAGCCCACACATAAGGCTGGG - Intergenic
1104390245 12:128385961-128385983 CAGTGCTCCCACAGAGAGCTGGG + Intronic
1104689291 12:130813384-130813406 CACTGCTAACACCTAGACCTGGG + Intronic
1106003927 13:25750957-25750979 CAGAGCACTCACAGAGAGCTTGG + Intronic
1106589778 13:31089336-31089358 CAGTGCCCACACACACAGCTCGG - Intergenic
1112033914 13:95480411-95480433 CACAGCTCACACCCAGAGCTGGG + Intronic
1113090176 13:106609846-106609868 CAGTTCACACACAGGGAGCTTGG - Intergenic
1114534929 14:23416850-23416872 CCCTGCACACACACACACCTCGG + Exonic
1115517343 14:34199051-34199073 CACTACACACACATCCAGCCAGG - Intronic
1118835193 14:69472952-69472974 AACTGCACACACAGGGATCTAGG + Intergenic
1119811427 14:77523620-77523642 TCCTGCACTCACATGGAGCTGGG + Intronic
1119904420 14:78288538-78288560 CACTGCACCCACATAGATCATGG - Intronic
1122858099 14:104569627-104569649 CTCTGCACACACACAGCACTTGG + Intronic
1123941709 15:25219775-25219797 CACCTCACACACACAGAGCTGGG - Intergenic
1123980232 15:25595451-25595473 CACTGTACTCACATAAAGCTAGG - Intergenic
1126690392 15:51284766-51284788 GAATGCACATACAAAGAGCTGGG + Intronic
1128333310 15:66770410-66770432 CAGTGCAGACCCATGGAGCTGGG + Intronic
1130112860 15:80980452-80980474 CTATGTTCACACATAGAGCTTGG - Intronic
1138519477 16:57562943-57562965 CACTGCACACACAGTGTCCTTGG - Intronic
1140988192 16:80179947-80179969 TACTGCACACACCTAAATCTAGG + Intergenic
1141616476 16:85212592-85212614 CCCTGCCCACACATTGACCTTGG + Intergenic
1148475960 17:47928695-47928717 CACTGTACACAAGTAGAGCTTGG - Exonic
1151393687 17:73804841-73804863 CACTGAACACACTTAGAGCATGG - Intergenic
1151830382 17:76545880-76545902 CTCTCCACATACACAGAGCTGGG + Intronic
1152518467 17:80840057-80840079 CACATCATACACATACAGCTTGG + Intronic
1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG + Intergenic
1159829781 18:73261808-73261830 CACTGAAAACACAGAAAGCTAGG + Intronic
1160938930 19:1610896-1610918 CACTGCACACAGACAGAACGGGG - Exonic
1162334307 19:10050858-10050880 CCCTGAATAAACATAGAGCTGGG + Intergenic
1164357328 19:27453853-27453875 AACTGCACACAAATATACCTTGG - Intergenic
1166307930 19:41945649-41945671 AACTGCAGACATCTAGAGCTGGG + Intergenic
925284749 2:2708625-2708647 CACTTTACACACACAGAGCCTGG - Intergenic
927062746 2:19439892-19439914 CAAAGCACACACATAGACCCAGG + Intergenic
928174078 2:29022508-29022530 CAGGGCACACACATAAAGCCAGG - Intronic
928296072 2:30085169-30085191 CCCAGCACTCACATAGGGCTGGG + Intergenic
932581738 2:72996460-72996482 GACTGGACACACAGAGGGCTCGG + Intronic
933322202 2:80791369-80791391 CACTGACCACTCATTGAGCTGGG - Intergenic
933940928 2:87244594-87244616 GACTGCACTCAGAGAGAGCTGGG + Intergenic
934526020 2:95052239-95052261 CACTGGGAACACGTAGAGCTGGG - Intronic
935886371 2:107623924-107623946 CACTGCAAACACCTTGATCTTGG + Intergenic
936352211 2:111721419-111721441 GACTGCACTCAGAGAGAGCTGGG - Intergenic
936512890 2:113162653-113162675 CACAGCAAACAAATAGAGATGGG - Intronic
937632290 2:124116570-124116592 CACTGCACATACATTGAGCTGGG + Intronic
939629011 2:144512786-144512808 CGCTGCACACACACAAGGCTGGG - Intronic
941741392 2:169039093-169039115 CACTGCAGATACTTAGAGCCTGG + Intergenic
944714422 2:202364579-202364601 AATTGTACACACATACAGCTGGG + Intergenic
946237831 2:218335549-218335571 CACTGAACACACACTGAGCAAGG - Intronic
946832182 2:223738189-223738211 CACCTCACACACAAAGAACTAGG - Intergenic
947473859 2:230424087-230424109 CACTGCATACATGTAGAGGTGGG + Intronic
948227138 2:236320022-236320044 CACGGCACACAGAGAGTGCTCGG + Intergenic
948697716 2:239741680-239741702 CCATCCACACACATGGAGCTGGG + Intergenic
1169454220 20:5738018-5738040 CCCTGCAGACCCACAGAGCTGGG - Intergenic
1174764540 20:53240299-53240321 CAGCGCCCACACATAGACCTGGG + Intronic
1175910389 20:62402582-62402604 CACTGCCCACACTTGGAGCTGGG - Intronic
1180597841 22:16990568-16990590 CACAGCCCACACATACAACTGGG - Intronic
1180983014 22:19888184-19888206 CACTGGCCACACATGGAGATGGG - Intronic
949288269 3:2432053-2432075 CACTGCACAAACAATGAGCCAGG + Intronic
949415301 3:3807453-3807475 CACATCACACATATAGAGCAGGG + Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
953046581 3:39298403-39298425 CACTGCAGGCATATGGAGCTGGG - Intergenic
953375797 3:42427645-42427667 GACTACACCCACAAAGAGCTGGG - Intergenic
955923232 3:63980413-63980435 CATAGTACACACATAGAGTTAGG - Intronic
957730482 3:84126583-84126605 CCATGTACACACATAGAGTTTGG - Intergenic
958652534 3:96956193-96956215 CAATCCATACACATAGAGATTGG + Intronic
966682957 3:182662715-182662737 CACTGGAAAAACATAGATCTTGG - Intergenic
967839484 3:193993506-193993528 CTCAGCAGACACAAAGAGCTGGG - Intergenic
968281328 3:197479054-197479076 CACTTCCCACACAAAGAGCTCGG - Intergenic
979243735 4:118474231-118474253 CAGTGCCCACACATAGGGCCAGG - Intergenic
981473087 4:145159212-145159234 CAATACACACACATATAGGTAGG + Intronic
984855187 4:184189079-184189101 CTCTGCACACTAAGAGAGCTGGG + Intronic
984959954 4:185086784-185086806 CAATCCACTCACACAGAGCTGGG - Intergenic
985572272 5:653993-654015 CACAGCACACACACACAGCAAGG - Intronic
986881859 5:12184017-12184039 CAATGAACACACATAGAGTTGGG + Intergenic
989468510 5:41786237-41786259 CACTCCACACACACAGAGAGAGG + Intronic
992701639 5:79346856-79346878 CACTGCCCACTCAAACAGCTAGG + Intergenic
997025079 5:130050645-130050667 CACTGCAATCACATAGAGTTGGG + Intronic
999019972 5:148154376-148154398 CACTGCAAACAGATACAGCAAGG - Intergenic
1003119315 6:3306905-3306927 CACTGCAGACACACACAGCCTGG - Intronic
1006403571 6:33831537-33831559 CCCTGCCCACCCATAGAGCTGGG + Intergenic
1007175395 6:39892870-39892892 CACTACACACACACACAGCAAGG + Intronic
1007513152 6:42390291-42390313 CCCTCCACACACACAGAACTTGG - Intronic
1007692181 6:43709710-43709732 CTCTGGACTCACATAGACCTGGG - Intergenic
1008885795 6:56430792-56430814 CAGCGCACACGCAGAGAGCTCGG + Intergenic
1013608675 6:111774099-111774121 CACTGGACACTGATAGAGATAGG + Intronic
1014152573 6:118075044-118075066 GACTGAACACACGTAGAGCAGGG - Intronic
1015241817 6:131032912-131032934 CACTGCACTCCCAAAGTGCTGGG - Intronic
1018865481 6:167744233-167744255 CACTTCAGAGAAATAGAGCTGGG + Intergenic
1019578826 7:1750228-1750250 CCCTGCGCCCACACAGAGCTTGG - Intergenic
1021048093 7:15948118-15948140 CACAGCACACACCCATAGCTAGG - Intergenic
1022653881 7:32300505-32300527 CTCTGCTCACAGATAGACCTGGG + Intergenic
1026610146 7:71851250-71851272 CACATCACACATATACAGCTGGG + Intronic
1027141029 7:75657691-75657713 CAGTGCACAGACATAATGCTGGG + Intronic
1029660699 7:101959219-101959241 CACTGCACACACATAGAGCTAGG - Intronic
1030008499 7:105141896-105141918 CAGTACACACACACAGGGCTTGG + Intronic
1031808310 7:126334435-126334457 CTATGCACACATACAGAGCTGGG + Intergenic
1032115179 7:129110864-129110886 CACTGCCCACTCACAGAGCCAGG - Intergenic
1033261598 7:139848812-139848834 CACTGCACAGTCATGGAGCAAGG + Intronic
1034990062 7:155542521-155542543 CACTGCACACCCCTGGGGCTGGG + Intergenic
1035875956 8:3189902-3189924 CACTGCTCACCCACACAGCTGGG + Exonic
1036785877 8:11686615-11686637 CACTGCACAGGCATAGTGGTAGG + Intronic
1041032563 8:53753012-53753034 CACTGAACACCCATAAAGTTTGG + Intronic
1042168837 8:65973145-65973167 CTCTGCAGGCACAAAGAGCTTGG + Intergenic
1042448459 8:68917164-68917186 CACTGAACACAGCTAGAGTTGGG + Intergenic
1043648990 8:82563315-82563337 CATTGCACACAGATAGATCTTGG + Intergenic
1044557427 8:93578978-93579000 CACTGCACACACATAGTATTTGG - Intergenic
1049299634 8:141862733-141862755 CGCTGCACCCACACAGAGCCTGG - Intergenic
1051225835 9:14898298-14898320 GCCAGCACACACATAGAGCAAGG + Intronic
1058967236 9:110049161-110049183 CCCTGTATACACACAGAGCTGGG + Intronic
1060189943 9:121586021-121586043 TTCTGCACACACGTAGAGGTAGG + Intronic
1060234145 9:121850518-121850540 CACTGCTCCCTCATGGAGCTGGG - Intronic
1062700790 9:137901305-137901327 CACGGCACAGACATAGGGATGGG - Intronic
1185782140 X:2857945-2857967 CCCTGAACACAGATGGAGCTAGG + Intronic
1186717675 X:12269742-12269764 CACTCCACACACACACAGCCAGG + Intronic
1188351442 X:29136083-29136105 CACTGCATAGTCATATAGCTTGG + Intronic
1192532038 X:71896395-71896417 ATCAGCACACACATAGAGCCAGG - Intergenic
1197562563 X:128041810-128041832 CACTGCAGACTCTTAGAGCAGGG - Intergenic