ID: 1029665429

View in Genome Browser
Species Human (GRCh38)
Location 7:101992194-101992216
Sequence TGTGCTTTAAGGAGCTCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 2, 2: 0, 3: 12, 4: 167}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029665429_1029665442 2 Left 1029665429 7:101992194-101992216 CCTACTGAGCTCCTTAAAGCACA 0: 1
1: 2
2: 0
3: 12
4: 167
Right 1029665442 7:101992219-101992241 GGAAAGTGGGACGGGGTTGGGGG No data
1029665429_1029665436 -7 Left 1029665429 7:101992194-101992216 CCTACTGAGCTCCTTAAAGCACA 0: 1
1: 2
2: 0
3: 12
4: 167
Right 1029665436 7:101992210-101992232 AAGCACAGGGGAAAGTGGGACGG 0: 1
1: 0
2: 2
3: 61
4: 665
1029665429_1029665443 3 Left 1029665429 7:101992194-101992216 CCTACTGAGCTCCTTAAAGCACA 0: 1
1: 2
2: 0
3: 12
4: 167
Right 1029665443 7:101992220-101992242 GAAAGTGGGACGGGGTTGGGGGG 0: 1
1: 2
2: 5
3: 53
4: 540
1029665429_1029665437 -6 Left 1029665429 7:101992194-101992216 CCTACTGAGCTCCTTAAAGCACA 0: 1
1: 2
2: 0
3: 12
4: 167
Right 1029665437 7:101992211-101992233 AGCACAGGGGAAAGTGGGACGGG 0: 1
1: 2
2: 0
3: 36
4: 371
1029665429_1029665438 -5 Left 1029665429 7:101992194-101992216 CCTACTGAGCTCCTTAAAGCACA 0: 1
1: 2
2: 0
3: 12
4: 167
Right 1029665438 7:101992212-101992234 GCACAGGGGAAAGTGGGACGGGG No data
1029665429_1029665439 -1 Left 1029665429 7:101992194-101992216 CCTACTGAGCTCCTTAAAGCACA 0: 1
1: 2
2: 0
3: 12
4: 167
Right 1029665439 7:101992216-101992238 AGGGGAAAGTGGGACGGGGTTGG No data
1029665429_1029665440 0 Left 1029665429 7:101992194-101992216 CCTACTGAGCTCCTTAAAGCACA 0: 1
1: 2
2: 0
3: 12
4: 167
Right 1029665440 7:101992217-101992239 GGGGAAAGTGGGACGGGGTTGGG 0: 1
1: 3
2: 3
3: 42
4: 475
1029665429_1029665441 1 Left 1029665429 7:101992194-101992216 CCTACTGAGCTCCTTAAAGCACA 0: 1
1: 2
2: 0
3: 12
4: 167
Right 1029665441 7:101992218-101992240 GGGAAAGTGGGACGGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029665429 Original CRISPR TGTGCTTTAAGGAGCTCAGT AGG (reversed) Intronic
900006987 1:64832-64854 TGTGCTTTTAAGATCTCAATGGG - Intergenic
902696364 1:18143389-18143411 TGTGATTTGAGAAGCTCAGCGGG - Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906235022 1:44201255-44201277 TTTTCTTTAAAGATCTCAGTTGG + Intergenic
907802004 1:57778115-57778137 TGTTCTTTAATCAGCTAAGTGGG + Intronic
911671190 1:100610040-100610062 TGTGTTTTAACAAGCTCTGTGGG + Intergenic
917232009 1:172847425-172847447 TGTGCTTTAACAAGCCCAGGGGG - Intergenic
917579700 1:176363143-176363165 TGTGCTTTAAGCAATTCAGTTGG - Intergenic
917621781 1:176803490-176803512 TGTGAATTATGGATCTCAGTTGG - Intronic
920079152 1:203359722-203359744 TCTGGTTTAAGGAGATCACTGGG + Intergenic
920208727 1:204312975-204312997 TGTGCTTTGAGAAGCTGAGGTGG - Intronic
920264254 1:204710154-204710176 TGTGCTTGAAGAAGCTCTCTGGG - Intergenic
920983807 1:210864365-210864387 TGTTCTTGAAGGAGCATAGTAGG - Intronic
921436296 1:215127203-215127225 AGTGCTTCACGGAGCTGAGTTGG + Intronic
923925279 1:238620119-238620141 TGTGCATTAACAAGCTCTGTAGG + Intergenic
1072323983 10:94277991-94278013 TGGGTTTTATGGAGCTCGGTGGG - Intronic
1072748106 10:97956159-97956181 TGTGCTTTAAGCAGCTGTTTTGG - Intronic
1073510954 10:104042068-104042090 GGTCCTTTAAGGAGCCCAGGTGG - Intronic
1074901955 10:117824673-117824695 TGATCTGTAAGGAGTTCAGTGGG - Intergenic
1077440931 11:2568741-2568763 TCTTCTCTAAGGAGCTCAGCCGG + Intronic
1081140672 11:39494768-39494790 TGTGTTTTAAGGAGTCCAGGAGG + Intergenic
1084458458 11:69282849-69282871 AGTGCTTAAGGGAGCACAGTGGG + Intergenic
1087138980 11:94747295-94747317 CATGCCTCAAGGAGCTCAGTTGG + Intronic
1088735653 11:112725752-112725774 AGTGCTTCAGGGAGCTCAGGAGG + Intergenic
1089893337 11:121903070-121903092 TGGGCCTCAAGGTGCTCAGTTGG - Intergenic
1089934463 11:122349489-122349511 TGTGCATTGAGGGGCTCAGAAGG - Intergenic
1089983012 11:122788266-122788288 TCTGGTTTAAAGAGCTAAGTTGG + Intronic
1094216061 12:27944067-27944089 CTTGCTTTAAGGAGCTTAGTGGG + Intergenic
1097878196 12:64662903-64662925 TGTGTTTTAAGGGGCTCAGGGGG + Intronic
1107509720 13:41071516-41071538 TTTGCTTTAAGCATCTCAGTGGG + Exonic
1113201324 13:107868806-107868828 TTTCCTTTAAGGAGCGCTGTGGG + Intergenic
1114931048 14:27467076-27467098 TGAGTTTTCAGGAGCTAAGTTGG - Intergenic
1115102069 14:29714212-29714234 TGTGCTGTAAGGAAATCACTGGG + Intronic
1115718105 14:36128071-36128093 AGTGCTCTAAGGAACACAGTTGG + Intergenic
1115802453 14:37010541-37010563 TGAGCCTGAAGGAGCTCAGGAGG + Intronic
1117553195 14:56856831-56856853 TGTGTTTTCAGGAGCTCTGATGG + Intergenic
1118832596 14:69448296-69448318 TTTGCTTTAAGTAGCTTGGTTGG - Intronic
1118915271 14:70097775-70097797 TGTACTTTAAAGAGCTCTTTAGG - Intronic
1119910948 14:78348758-78348780 TGTGTTTTCATGAGCTCTGTGGG + Intronic
1120476958 14:85000211-85000233 AGTGCTTTAAGGAGATCTATAGG - Intergenic
1120917793 14:89725019-89725041 TGTGCTTTAATAAGCAAAGTTGG - Intergenic
1121259234 14:92553971-92553993 TGTGCTGTAAGGAGCCCCTTGGG - Intronic
1121276069 14:92668559-92668581 GTAGCTTCAAGGAGCTCAGTGGG + Intronic
1121498514 14:94414716-94414738 TGTGCTGAGAGCAGCTCAGTAGG - Intergenic
1122877973 14:104677578-104677600 AGGGCTTTCAGGAGCTCAGCAGG - Intergenic
1124693757 15:31846452-31846474 TGTTCTTTAGGGTTCTCAGTGGG - Intronic
1128398352 15:67252209-67252231 TGTGCTTTAATGATCCCAATCGG - Intronic
1128660864 15:69500015-69500037 TGTGCTCCAGTGAGCTCAGTGGG - Intergenic
1128706727 15:69842318-69842340 TGTGCTTTCAGGTGCTCCGGAGG + Intergenic
1133779288 16:8924860-8924882 TGTGCTGTAAGCAACTCAGCAGG - Intronic
1138966150 16:62086374-62086396 TGTGCTTTAACGAGCTCTCTGGG - Intergenic
1139873794 16:70128827-70128849 TGCGCTTCAGGGAGATCAGTCGG - Exonic
1140361985 16:74352313-74352335 TGCGCTTCAGGGAGATCAGTCGG + Intergenic
1140424375 16:74848583-74848605 TGTGCTTAGAGGAGCTTTGTTGG - Intergenic
1140554436 16:75905347-75905369 TGTGCTTTTAAGAGCTTACTAGG + Intergenic
1146631701 17:34474542-34474564 TAGGCTTTGAGGAGCTCAGGAGG + Intergenic
1146638259 17:34521823-34521845 TGTCCTCTCAGGAGCTCAGCAGG + Intergenic
1146663892 17:34683755-34683777 CATGCTCTAAGGAGCTCATTTGG - Intergenic
1148129720 17:45255525-45255547 TGTGGTTGGAGGAGCTGAGTGGG + Exonic
1148260739 17:46180953-46180975 TGTGCTTTAGAGAGATCAGTTGG + Intronic
1148733193 17:49850355-49850377 TGCGCTTGGGGGAGCTCAGTGGG - Intergenic
1149242553 17:54667247-54667269 TATATTTTAAGGAGCTGAGTTGG + Intergenic
1151865373 17:76798412-76798434 TGCCCTTTCAGGAGATCAGTGGG + Intergenic
1153313754 18:3702352-3702374 TGTGCTTCATGGTGCTCAATTGG + Intronic
1153922417 18:9803647-9803669 TCTCCTTAAAGGAGCTCAGCAGG - Intronic
1155483411 18:26314550-26314572 TGTGGTTTAACGAATTCAGTTGG + Intronic
1157972601 18:52287349-52287371 TGTGCCTTAGAGAACTCAGTAGG + Intergenic
1158351304 18:56567247-56567269 TGTGCTTTAAGGAGCCCTCCAGG - Intergenic
1158440382 18:57469937-57469959 TGTACTGTAAGAAGCTCAGATGG - Intronic
1160638743 19:106416-106438 TGTGCTTTTAAGATCTCAATGGG - Intergenic
1162489872 19:10985730-10985752 TCTGCTTTAATGAGCCCAGCAGG + Intronic
1162843191 19:13371496-13371518 TTTGCTTTCAGGAGCTCATGGGG + Intronic
1165892885 19:39125553-39125575 TCCCCTTTAAGGACCTCAGTGGG + Intergenic
928195778 2:29215606-29215628 TGGGCTTTAAGGATCTGGGTTGG + Intronic
928620647 2:33084499-33084521 TGGGCTTTAGGGAACTCTGTTGG + Intronic
929022066 2:37563264-37563286 TGAGCTTTGAGGAGCTCTGGTGG + Intergenic
931216185 2:60247247-60247269 TGTGCTTTTGGTAGCTCACTGGG - Intergenic
931845544 2:66200079-66200101 TGTGATTTAAGGAACACACTAGG - Intergenic
933289538 2:80422511-80422533 TGTGATTTCTGGATCTCAGTGGG + Intronic
936146573 2:109984519-109984541 TGGGCCTTGAGGAGCTCAGGGGG + Intergenic
936198117 2:110386960-110386982 TGGGCCTTGAGGAGCTCAGGGGG - Intergenic
938600771 2:132836909-132836931 TGTGCTTTAAGAAACGGAGTGGG - Intronic
941052532 2:160750583-160750605 TGCCCAGTAAGGAGCTCAGTGGG + Intergenic
1169421746 20:5466104-5466126 TGTGCTTAAAGGAGAACACTTGG + Intergenic
1169609292 20:7361299-7361321 GGTGCTGTAAGGAGCTCATTTGG - Intergenic
1175092560 20:56517178-56517200 TGTGCTTTTGGGAGCCAAGTTGG - Exonic
1182518518 22:30872193-30872215 TGGGCTGTAAGGAGGACAGTGGG - Intronic
1182687249 22:32130743-32130765 TGTGCTTGCAGGAGCTGAGATGG + Intergenic
1183060790 22:35335263-35335285 TGACCTCTAAGGAGCTGAGTGGG - Intronic
1183401919 22:37609672-37609694 TGTGGGTTAAGGAGCTCAGGTGG - Intronic
1184667515 22:45996666-45996688 TCCGCTTTGTGGAGCTCAGTGGG + Intergenic
949226581 3:1702068-1702090 TATTCATTAAAGAGCTCAGTAGG + Intergenic
949635701 3:5979374-5979396 TTTGTTTTAATGAGCCCAGTAGG - Intergenic
949874963 3:8620555-8620577 GGTGCGTGAAGGAGCACAGTAGG - Intronic
952181583 3:30921902-30921924 TGTGCTTTAGGGACCTCAAGGGG + Intergenic
952985503 3:38777287-38777309 TTAACTTTAAGGAGCTCAGCAGG + Intronic
956417120 3:69044174-69044196 TGTGCTATAAGGAGCTGATTGGG - Intronic
957007204 3:74963580-74963602 TGTGCTTTAGGGAGCTGGATGGG - Intergenic
958735868 3:98008999-98009021 TGTGCTTTATGGATTTCAGCAGG - Exonic
962145354 3:132834447-132834469 TGTGCTTTAACGAGCCCACAGGG + Intergenic
962535739 3:136327506-136327528 TGGGCCTTCAGGAGCCCAGTAGG + Intronic
962621613 3:137185815-137185837 TGTGCTATAAACAGGTCAGTCGG - Intergenic
963564468 3:146910847-146910869 TGTGCTTTAAAAAGGCCAGTTGG - Intergenic
963778742 3:149465644-149465666 TGTGCTTCCAGCTGCTCAGTGGG + Intergenic
966014014 3:175118491-175118513 TGTGCTTTAATGAGAACAGCAGG + Intronic
967111902 3:186301283-186301305 TGTGCTTTAGGAAGATCAATAGG - Intronic
967670065 3:192222544-192222566 TGTTCTTTAGGAAGCTCAGTTGG + Intronic
968635276 4:1675293-1675315 TGTGCTTCCCGGAGCTCAGGTGG - Intronic
968973897 4:3811202-3811224 TGTGCGGTGAGGAGCTCAGAGGG - Intergenic
970798677 4:19946148-19946170 TGTGCTTCAAATGGCTCAGTTGG + Intergenic
975327222 4:73072139-73072161 TGTGCTTTGGGAAGCTGAGTGGG + Intergenic
975358480 4:73437287-73437309 TGTGCTTTTAAGAGCTCACAGGG - Intronic
975732883 4:77354669-77354691 GGTGCTTAGAGGACCTCAGTGGG + Intronic
975734482 4:77367778-77367800 GGTGCTTAGAGGACCTCAGTGGG + Intronic
978858101 4:113416227-113416249 TTTGCTTTGTGGAGATCAGTTGG + Intergenic
979563780 4:122130966-122130988 GATGAATTAAGGAGCTCAGTAGG - Intergenic
979564090 4:122134600-122134622 GTTGAATTAAGGAGCTCAGTAGG - Intergenic
979611482 4:122693396-122693418 TGTGCTTTAAGGATTTCTCTAGG - Intergenic
980236385 4:130112610-130112632 TGTGCTTTAAGAAGCTCTCCAGG + Intergenic
980679185 4:136134044-136134066 TGTGATGTAAGTAACTCAGTAGG - Intergenic
985369846 4:189275041-189275063 TGTATTTTAAGGAGATCCGTAGG - Intergenic
986309646 5:6542795-6542817 TGTGGCTGAAGGAGCTCTGTGGG - Intergenic
987705832 5:21461295-21461317 GGTACTTTAAGGAGCTAAGAGGG - Intergenic
989057725 5:37381111-37381133 GGTACTTTAAGGAGCTAAGAGGG - Intronic
989503426 5:42196821-42196843 GATGATTTAAGGAGCTTAGTTGG - Intergenic
993014092 5:82516323-82516345 TGAGCTTAAAGGAGCTCTGGAGG - Intergenic
994941095 5:106325298-106325320 AGTGCTTTGAGGAGATCAGAAGG + Intergenic
995729109 5:115217203-115217225 TGTGATTTAAAGGGTTCAGTTGG - Intronic
996231814 5:121073671-121073693 TGTGTTTTAATGAGCTCACCAGG - Intergenic
998747568 5:145278264-145278286 GTTGCTTTAAGCAGCTAAGTTGG - Intergenic
998929824 5:147168958-147168980 TGTGATTTAAGGCACTCAGGGGG + Intergenic
999370145 5:151049999-151050021 TGAGCATTAAGGAGCCCTGTAGG - Intronic
1009022454 6:57959577-57959599 GGTACTTTAAGGAGCTAAGAGGG + Intergenic
1009468448 6:64002419-64002441 TGTGTGTTAATCAGCTCAGTGGG - Intronic
1009634034 6:66240490-66240512 TGTGCTTTTATAAGCTCTGTAGG - Intergenic
1010774602 6:79870535-79870557 TGTCCTTTAAGGAACTCAGATGG - Intergenic
1013089013 6:106882536-106882558 TGTAGTTTAATGATCTCAGTTGG - Intergenic
1013102292 6:106997030-106997052 CTTTCTTTAAGGAGCTCAGCTGG - Intergenic
1015614517 6:135061102-135061124 TGTGCTTTAAGGCACACAGGAGG - Intronic
1017173973 6:151484515-151484537 AGTGCTTTAAGAGGCTCAGGTGG - Intergenic
1017606914 6:156144644-156144666 AGTGCTGTAGGGAGCTCAGCAGG + Intergenic
1018039502 6:159909542-159909564 TTTGCTTTCAGGAGCCCAGATGG + Exonic
1020196362 7:6042541-6042563 TTTGCTACAAGGAGCTCAGGAGG - Intronic
1021512767 7:21452248-21452270 TGTGCTTTATGCAACTCATTAGG - Intronic
1023912520 7:44566040-44566062 TGTGCTTGAAGCTGCGCAGTGGG + Exonic
1024488082 7:49943287-49943309 TGTGCTAAAAGGAGTTAAGTAGG - Intronic
1024677399 7:51649117-51649139 TGTGGTTTGAGGGGCACAGTAGG + Intergenic
1025189593 7:56886588-56886610 TGAGCTTTAAGGAGCTCAGTAGG - Intergenic
1025201319 7:56963639-56963661 TTTGCTACAAGGAGCTCAGGAGG - Intergenic
1025670625 7:63613294-63613316 TTTGCTACAAGGAGCTCAGGAGG + Intergenic
1025682347 7:63690329-63690351 TGAGCTTTAAGGAGCTCAGTAGG + Intergenic
1026576998 7:71580748-71580770 TGTTCTCTAAGGAGCACTGTTGG + Intronic
1027650415 7:80860453-80860475 TGTGTTTTAAGGGGTGCAGTTGG - Intronic
1028204027 7:87995658-87995680 TGTGCTTTTAGAAGCTCTCTGGG + Intronic
1029608496 7:101614226-101614248 GGTTCTTAAGGGAGCTCAGTGGG + Intronic
1029665429 7:101992194-101992216 TGTGCTTTAAGGAGCTCAGTAGG - Intronic
1030797754 7:113809827-113809849 TGTGGTTTAAGACACTCAGTTGG - Intergenic
1031278990 7:119771545-119771567 TGTGCTTTAAGAATCACAGGAGG + Intergenic
1031431046 7:121669961-121669983 TGTCTTTTAAGGAGCACAGATGG - Intergenic
1031633580 7:124074170-124074192 TGTGCTATAAAGAGCTGAGAGGG - Intergenic
1032491741 7:132329095-132329117 TGTGCTTCAAGGAGCACTGCAGG + Intronic
1033356775 7:140606737-140606759 GGGGGTTTAAGGAACTCAGTGGG - Intronic
1040321763 8:46313424-46313446 TTTGCATTATGGGGCTCAGTGGG + Intergenic
1040376433 8:46829457-46829479 TGTGATGTTAGGAGTTCAGTAGG + Intergenic
1040848379 8:51871173-51871195 TCCTCTTTAAGGAGGTCAGTAGG - Intronic
1041878794 8:62722338-62722360 AGTGTTTTAAGGAGCCCAGAGGG - Intronic
1041984057 8:63899390-63899412 TCTGCTTTAAAGACCACAGTAGG - Intergenic
1046560520 8:115831641-115831663 TGTTCTTAAAGGAAATCAGTTGG + Intergenic
1046748958 8:117906606-117906628 TGTGCTTTAAGGAATTTCGTAGG - Intronic
1047362685 8:124183645-124183667 CCTGCTTTAGGGAGCTCAGAGGG + Intergenic
1047783000 8:128124894-128124916 TCTGCTTTGAGGAGCTAAGTTGG - Intergenic
1049679431 8:143911114-143911136 TGTGCTTTAAGGAGCCCTCCAGG - Intergenic
1050016344 9:1238040-1238062 TGCGCTTTAAGTAGCTCATAAGG - Intergenic
1052796163 9:32925408-32925430 TAAGCTGTAAGGAGCACAGTTGG - Intergenic
1053076766 9:35140403-35140425 TGTGCCTCAAGGTGCTAAGTTGG - Intergenic
1055698427 9:78915322-78915344 TATGCTTTAAGAACTTCAGTAGG - Intergenic
1061085696 9:128396937-128396959 TGGGCTTTAAATACCTCAGTTGG - Intergenic
1189326205 X:40112901-40112923 TCTGCTTTAAGCACCTGAGTGGG - Intronic
1189624858 X:42886077-42886099 GGAACTTTAAGAAGCTCAGTAGG + Intergenic
1197932735 X:131712217-131712239 GGTGCTCCAAGGTGCTCAGTAGG - Intergenic
1199620208 X:149693466-149693488 TCAGCTTTTATGAGCTCAGTAGG + Intronic
1200648595 Y:5814638-5814660 TCTGCTTACAGGAGCCCAGTGGG + Intergenic