ID: 1029669547

View in Genome Browser
Species Human (GRCh38)
Location 7:102019684-102019706
Sequence GTACAACTCCACCACGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029669547_1029669555 25 Left 1029669547 7:102019684-102019706 CCCTTCCCGTGGTGGAGTTGTAC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1029669555 7:102019732-102019754 TCAGCATTGGAGACTCTGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1029669547_1029669553 12 Left 1029669547 7:102019684-102019706 CCCTTCCCGTGGTGGAGTTGTAC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029669547 Original CRISPR GTACAACTCCACCACGGGAA GGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
906791982 1:48667142-48667164 GTACATCTCCACCTCTTGAAAGG - Intronic
921877197 1:220211143-220211165 GTAAAACTCCACCACTGGTAAGG + Intronic
1069276000 10:66591644-66591666 TTAAAATTCCACCACAGGAAAGG - Intronic
1070676373 10:78414456-78414478 GTTCAACACCACCACAAGAAGGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1114188632 14:20423484-20423506 GAAGAACACCACCAAGGGAATGG + Intergenic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1129350780 15:74955023-74955045 GTACATCGCCACTAAGGGAAAGG - Exonic
1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG + Intergenic
1142702861 17:1674781-1674803 GCACAACTCCGCCTCGGGAGTGG - Intronic
1145942019 17:28747555-28747577 GTATCCCTCCACCAGGGGAAAGG + Intronic
1151090926 17:71439529-71439551 GTAGAACTCCAGCTCAGGAATGG + Intergenic
1156630526 18:38962933-38962955 GTACAACCCAGACACGGGAAAGG - Intergenic
1161376129 19:3939896-3939918 GTACAAGTCCACCAGGGGCCTGG - Exonic
1161641558 19:5426877-5426899 GTACATCTCCCCCACTGGGAGGG - Intergenic
925040693 2:731462-731484 GGACAACTCCACAAGGGGAGGGG - Intergenic
928828103 2:35444547-35444569 ATACAAGTCTACCAAGGGAAAGG - Intergenic
932356565 2:71072630-71072652 GCACAACTCCACCTGGGGAAAGG - Exonic
944177679 2:196850968-196850990 GTTCAACTCCAGCAAGGGGATGG + Intronic
947661633 2:231873854-231873876 ATACCACTTCACAACGGGAATGG + Intergenic
960743550 3:120861475-120861497 GTACAACTCTACTATAGGAAGGG - Intergenic
961843660 3:129740533-129740555 TCTCAACTCAACCACGGGAAGGG + Intronic
962914887 3:139892139-139892161 GTACAACTGCACCAAGGCAGTGG - Intergenic
964244363 3:154633589-154633611 ATACCACACCACCACGGCAAGGG + Intergenic
978191440 4:105917301-105917323 GTAGAAATTCACCATGGGAATGG - Intronic
983271372 4:165566045-165566067 CTACTACTCCACCACAGGTATGG - Intergenic
998905039 5:146895827-146895849 GTCCATCTCCACCACAGGAAAGG + Intronic
1001955976 5:175848374-175848396 GTACAAGTCAACCAGGGGACAGG + Intronic
1010816068 6:80359396-80359418 GTCCCAGTTCACCACGGGAAGGG - Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1020114871 7:5470692-5470714 GGACATCTCCCCCCCGGGAAGGG - Intronic
1020114882 7:5470714-5470736 GGACATCTCCCCCCCGGGAAGGG - Intronic
1025192350 7:56905424-56905446 GTATAACTCCACAATGGGAAGGG - Intergenic
1025679599 7:63671507-63671529 GTATAACTCCACAATGGGAAGGG + Intergenic
1027156375 7:75771211-75771233 GTACAACTCCACCAATTTAAAGG + Intronic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1031597236 7:123662414-123662436 GTCCAACTTCATAACGGGAAAGG + Exonic
1035461528 7:159041950-159041972 GCCCAACTCCACCTGGGGAACGG + Intronic
1039463578 8:37765811-37765833 GTACAACTCAACCACCAGGATGG - Intronic
1047951433 8:129939250-129939272 GGACAACGCCGACACGGGAAGGG + Intronic
1052261795 9:26525284-26525306 GGACAACTCTATCAGGGGAAGGG + Intergenic
1195220657 X:102742976-102742998 GGACAACTCCAAGAGGGGAAGGG + Intronic
1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG + Intergenic
1200857856 Y:7958802-7958824 GTCCACCTCCACCACAGGATAGG - Intergenic