ID: 1029669553

View in Genome Browser
Species Human (GRCh38)
Location 7:102019719-102019741
Sequence AAAAGCCACAGCATCAGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 2, 2: 1, 3: 19, 4: 212}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029669549_1029669553 7 Left 1029669549 7:102019689-102019711 CCCGTGGTGGAGTTGTACCACGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212
1029669547_1029669553 12 Left 1029669547 7:102019684-102019706 CCCTTCCCGTGGTGGAGTTGTAC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212
1029669542_1029669553 23 Left 1029669542 7:102019673-102019695 CCCAAAGCCAGCCCTTCCCGTGG 0: 1
1: 0
2: 4
3: 32
4: 233
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212
1029669541_1029669553 24 Left 1029669541 7:102019672-102019694 CCCCAAAGCCAGCCCTTCCCGTG 0: 1
1: 0
2: 5
3: 25
4: 211
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212
1029669539_1029669553 30 Left 1029669539 7:102019666-102019688 CCAGTCCCCCAAAGCCAGCCCTT 0: 2
1: 1
2: 3
3: 47
4: 438
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212
1029669540_1029669553 25 Left 1029669540 7:102019671-102019693 CCCCCAAAGCCAGCCCTTCCCGT 0: 1
1: 1
2: 3
3: 27
4: 298
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212
1029669544_1029669553 22 Left 1029669544 7:102019674-102019696 CCAAAGCCAGCCCTTCCCGTGGT 0: 1
1: 0
2: 1
3: 20
4: 181
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212
1029669551_1029669553 -10 Left 1029669551 7:102019706-102019728 CCACGTACCACGCAAAAGCCACA 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212
1029669546_1029669553 16 Left 1029669546 7:102019680-102019702 CCAGCCCTTCCCGTGGTGGAGTT 0: 1
1: 0
2: 3
3: 8
4: 126
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212
1029669550_1029669553 6 Left 1029669550 7:102019690-102019712 CCGTGGTGGAGTTGTACCACGTA 0: 1
1: 0
2: 1
3: 16
4: 341
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212
1029669548_1029669553 11 Left 1029669548 7:102019685-102019707 CCTTCCCGTGGTGGAGTTGTACC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG 0: 1
1: 2
2: 1
3: 19
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029669553 Original CRISPR AAAAGCCACAGCATCAGCAT TGG Intronic
905150358 1:35922240-35922262 AAAAGCAAGAGAATCAGCTTTGG + Exonic
905168415 1:36097000-36097022 TGATGCCACAGCATCACCATGGG + Exonic
905879727 1:41455718-41455740 AGAAGGGACAGCATCAGCAAAGG - Intergenic
913321307 1:117590527-117590549 AAAGGGAACAGAATCAGCATGGG + Intergenic
913558401 1:119992768-119992790 AAAAGCCACAGAATGTGCTTAGG + Intronic
913639440 1:120797683-120797705 AAAAGCCACAGAATGTGCTTAGG - Intergenic
914626591 1:149468022-149468044 AAAAGCCACAGAATGTGCTTAGG - Intergenic
915891009 1:159774013-159774035 AAAAGGCACAGCATGGGCACAGG + Intergenic
916068452 1:161155303-161155325 AAAAGGGACAGCATGAGCAAAGG + Intronic
917471062 1:175326353-175326375 AGAAGCCACAGAATCAGAATAGG - Intronic
917811298 1:178660956-178660978 ATACACCACAGCATCACCATGGG + Intergenic
918160934 1:181898902-181898924 AAAAGCATCTGCATCAGCAAGGG + Intergenic
921174602 1:212583264-212583286 AACAGCCACTGCACCAGCCTGGG - Intronic
922891421 1:229064823-229064845 CAATGCCACCGCATCAGCAACGG + Intergenic
924292614 1:242553399-242553421 AAAAGCAACAGCAACTGCAGTGG - Intergenic
924778040 1:247124495-247124517 AAAAGCCACAGAATCAGAGCCGG - Intronic
924898066 1:248363773-248363795 AAAAGGCACAGCAAGAGCAAAGG + Intergenic
1063033707 10:2263240-2263262 ATAAGCCTCAGCTTTAGCATAGG + Intergenic
1065370396 10:24979269-24979291 ACCAGCCACAACATTAGCATTGG - Intergenic
1065734796 10:28741738-28741760 AAAAGACAAAAGATCAGCATTGG + Intergenic
1069243970 10:66178655-66178677 AAAAACCACAACATCAACAAAGG + Intronic
1070171545 10:73936871-73936893 AAAAGCCACAACATCATTTTAGG + Intergenic
1071358898 10:84825752-84825774 AAAAGCCAGAGTAGCAACATTGG + Intergenic
1071422437 10:85514067-85514089 ATAAGCCACAGCCTCAGGACAGG + Intergenic
1071719783 10:88131703-88131725 AAAAGCCCCAGCATTAGTACCGG + Intergenic
1072132913 10:92514230-92514252 AAAAGCAACACCATCGGCAGTGG + Intronic
1073485951 10:103819395-103819417 AAAAGAAACAGCATAAGCAAAGG + Intronic
1075248334 10:120844781-120844803 AAAAGCCAAAACATGATCATTGG + Intergenic
1079362227 11:19778553-19778575 GAAAGTCACAGCAGCTGCATTGG + Intronic
1079696796 11:23491679-23491701 CCAGGCCACAGCTTCAGCATTGG - Intergenic
1080274018 11:30483325-30483347 AGAAGCAGTAGCATCAGCATAGG + Intronic
1080704775 11:34680083-34680105 CTAAGCCTCAGCATCACCATTGG + Intergenic
1081286810 11:41280420-41280442 AAAATACAAAGCATGAGCATGGG - Intronic
1083165082 11:60879637-60879659 AAAAGCCAGAAAATAAGCATTGG + Intergenic
1084279448 11:68077835-68077857 AAAAGCCACAGCAGCCCCATGGG + Intronic
1085817036 11:79748793-79748815 TCTAGCCACAACATCAGCATGGG + Intergenic
1086313107 11:85558521-85558543 CAAAGACACAGAATCAACATAGG + Intronic
1088721011 11:112591776-112591798 AAAACCCAAAGCAACAGCAAGGG + Intergenic
1089171323 11:116513653-116513675 GAAGGGCACAGCATGAGCATGGG - Intergenic
1089846754 11:121464778-121464800 CAGAGCCACAGCATCCGCACAGG - Intronic
1090146788 11:124333039-124333061 CAAAGCCACACAATCAGGATGGG - Intergenic
1090766296 11:129879150-129879172 AGAAGCCACAGGACCATCATCGG + Intronic
1091304552 11:134529349-134529371 GAGAGCCACTGCATCAGCAGCGG - Intergenic
1093025857 12:14244617-14244639 TGCAGCCACAGCATAAGCATGGG - Intergenic
1093987552 12:25553367-25553389 AGAAGGTACAGCATCAACATAGG - Intronic
1094497599 12:30998268-30998290 CAAAGGCACAGCTTCAGCAATGG - Intergenic
1096479363 12:51928067-51928089 AAAAGCCAATGCATCTACATTGG + Intergenic
1096588067 12:52636668-52636690 AACAGCAACAGCAACAGCACGGG + Intergenic
1096984673 12:55748552-55748574 GAAGGGCACAGCATCAGCAAAGG - Intronic
1097338582 12:58412440-58412462 CATAGCCAGAGCAGCAGCATGGG + Intergenic
1099244804 12:80181654-80181676 ATAGGCAACAGCATCAGCAAAGG + Intergenic
1100541082 12:95558035-95558057 AAGAGCCACAGCTTCTGCCTTGG + Intergenic
1105212863 13:18267466-18267488 AATGCCCACAGCATGAGCATCGG - Intergenic
1105401435 13:20099584-20099606 ATAGGCCACAGCCTCAGCCTTGG + Intergenic
1105787035 13:23759776-23759798 AAAACCCACAGGAGCAGCAGGGG + Intronic
1107026279 13:35804866-35804888 AACAGCCACAGAGGCAGCATCGG + Intronic
1107802845 13:44126563-44126585 CACAGCCACAGCATAACCATAGG - Intergenic
1109459799 13:62641693-62641715 AATAGCCACTGCATTAGCAGGGG - Intergenic
1110696407 13:78496447-78496469 AAAAGACACAGCATGAGCAAAGG + Intergenic
1111715539 13:91875056-91875078 GAAACCCACAGCAACAGCCTTGG - Intronic
1112571945 13:100601256-100601278 AGAAGCAACAGCATCTGCAAAGG - Intergenic
1112626499 13:101110647-101110669 AACAGCCAGAGGATCAGCAGGGG - Exonic
1113396979 13:109956876-109956898 AAAAACCAGAGCATTAGCTTTGG + Intergenic
1116579861 14:46626446-46626468 AAAAGCAACAACATCAGGATAGG + Intergenic
1117968914 14:61233180-61233202 AAAAGCCAGAGTGTCAGCCTGGG + Intronic
1118137481 14:63045510-63045532 AGCAGCCTCAGCATCAGCACCGG - Intronic
1118157076 14:63252734-63252756 AAAGGCAACAGCATCAGGAAAGG + Intronic
1118410558 14:65472677-65472699 TAAATCCAAAGTATCAGCATAGG - Intronic
1121022054 14:90586234-90586256 AAGAGCCACAGCATCTGAAGGGG - Intronic
1121487965 14:94333426-94333448 AAAAGCCAAAAGATAAGCATTGG - Intergenic
1122014918 14:98787099-98787121 AAAACTCACAGCCTCAGCAGGGG - Intergenic
1122370394 14:101226159-101226181 AAAGGGCACAGCAGCAGCAGGGG + Intergenic
1125749511 15:42019240-42019262 AAAAGCCTCAGCCTCCTCATTGG + Intronic
1125873318 15:43122418-43122440 AAAGCCCACAGCATCACTATTGG + Intronic
1127308237 15:57728787-57728809 AGAAGCCACAGCATTCGCAGAGG + Intronic
1127474078 15:59315774-59315796 AACAGCAACAGCAGCAGCATTGG - Intronic
1128252149 15:66171139-66171161 AAGAGCCACAGCAGCAACAGCGG - Intronic
1129456328 15:75677749-75677771 AAAAGACACAGCCACAGCAAGGG + Exonic
1129523070 15:76197911-76197933 AAAACCCACATAATGAGCATTGG + Intronic
1130180836 15:81626598-81626620 AAAAGACAAAGCAACAGCTTAGG + Intergenic
1130976311 15:88778188-88778210 AAAGGCAACAGGCTCAGCATAGG - Intergenic
1131345122 15:91639556-91639578 AAAGGCCACAGCAGCTACATTGG + Intergenic
1133067225 16:3217136-3217158 AGAATACACAGCATCAGCATCGG + Intergenic
1133268871 16:4600654-4600676 AACAGCCACTGGGTCAGCATGGG - Exonic
1134864206 16:17590357-17590379 AGAAACCACAGCATCAGTTTTGG + Intergenic
1135083749 16:19458177-19458199 AAAAGAAACAGCATCTCCATTGG - Intronic
1138103721 16:54275350-54275372 AGCACCCACAGCATCAGCCTGGG - Intergenic
1138476586 16:57273769-57273791 AACAGCAACAGCAACAGCCTGGG + Intronic
1142057127 16:88004991-88005013 AAAAGCAACAGCATCCTCAGGGG - Intronic
1143013956 17:3881862-3881884 AGAACCATCAGCATCAGCATGGG + Intronic
1143102396 17:4511649-4511671 CAAAGCCACAGCCTCTGCCTTGG + Intronic
1143452795 17:7046033-7046055 AAAAGACACAGCATGACTATAGG + Intergenic
1150590356 17:66556933-66556955 GAACCCCACAGCATCAGGATAGG + Intronic
1150887259 17:69101608-69101630 AAAAGCAGCAGCAGCAGCAAAGG + Intronic
1151342867 17:73482862-73482884 AACAACCACAGTAGCAGCATCGG + Intronic
1151883688 17:76911008-76911030 AAAAGTAACAGCATCAGCTATGG + Intronic
1151991936 17:77580892-77580914 AGAAGCCACAGCCTCAGCCTTGG - Intergenic
1153598150 18:6750305-6750327 AAAAGCAACAGCAGCAGCATTGG - Intronic
1154329124 18:13415400-13415422 AAGAGCCACATCATCAGCTCAGG - Intronic
1155649174 18:28119760-28119782 AAAAGGCACAGCAACCTCATGGG - Intronic
1159338593 18:67103719-67103741 AAAAGTCATAGCATAAGCAAAGG - Intergenic
1159615350 18:70573333-70573355 TAAACCCACAGCATTAGCACGGG - Intergenic
1160262456 18:77307526-77307548 AGAGGCCACAGCAACAGCACAGG - Intergenic
1167405366 19:49303684-49303706 AAAAGCCACACCATTAGAACTGG + Intronic
1167981707 19:53281607-53281629 AAAACCCACAGGAGCAGCAGAGG + Intergenic
925043866 2:755922-755944 AGAAGCCACATCCTCAGCAGAGG + Intergenic
926566044 2:14475351-14475373 CAAAGACATAGAATCAGCATAGG + Intergenic
928828432 2:35448136-35448158 AAAAGTCACTCCATCAGGATGGG + Intergenic
929579494 2:43072674-43072696 GAAATCCACAGCATCAGCACAGG + Intergenic
930572346 2:53102845-53102867 AAAAGCCACAACATCCACAGAGG + Intergenic
931498114 2:62834017-62834039 AATAGCAAGAGGATCAGCATTGG + Intronic
933673672 2:85033729-85033751 TGAAGCCACAGCATGAGCTTTGG + Intronic
936257261 2:110927454-110927476 AAAGGCCACAGCAGGAGCACAGG - Intronic
937632415 2:124118303-124118325 AAAAGCCACAGCACCCACCTTGG + Intronic
937862664 2:126723093-126723115 ATATGCCACAGCAAAAGCATAGG - Intergenic
940266940 2:151848729-151848751 AACAGCCACAGGGTCAGCTTTGG + Intronic
940886111 2:158990618-158990640 CAAAGCAACAGCATGAGCAATGG + Intronic
942329173 2:174804100-174804122 AAAAACAGCAGCATAAGCATTGG + Intronic
945120340 2:206451139-206451161 AAGAGCCACAGAATCGGCAGAGG + Intronic
945823914 2:214697625-214697647 AGGAGCCAAAGCAGCAGCATAGG + Intergenic
946153306 2:217790538-217790560 AAGAGCGACAGCATCAGTAGGGG - Intergenic
947016890 2:225630780-225630802 TAAAGCCACAGAGTCATCATTGG - Intronic
947764768 2:232630512-232630534 AAAAGGCACATCATCTGCAAGGG - Intronic
948217257 2:236240853-236240875 AAATGCCACAGCTACAGCAGGGG - Intronic
1168861138 20:1046758-1046780 AACAGCCTCAGCATCAACAATGG + Intergenic
1169184042 20:3597487-3597509 AAAAGCCATGGCATTAGCGTTGG - Intronic
1170787857 20:19482961-19482983 AAAGACCACAGCAACACCATGGG - Intronic
1171389848 20:24794415-24794437 AGAGGCCACAGCCTAAGCATGGG - Intergenic
1173113623 20:40219326-40219348 CAAATCCACAGCATCATCTTTGG + Intergenic
1173383920 20:42571100-42571122 AAATATTACAGCATCAGCATGGG - Intronic
1174474179 20:50784172-50784194 AAAAGCCACAGAAGCACCACCGG - Intergenic
1174682022 20:52417683-52417705 AAAAGGAACAGCATCAGAAAAGG - Intergenic
1181058779 22:20272211-20272233 CAAAGCCACAGCAGCAGCAAAGG + Intronic
1183251370 22:36732742-36732764 AAAAGGCACAGCATGTGCAAAGG - Intergenic
949528648 3:4931686-4931708 AAAATTAACAGCACCAGCATGGG + Intergenic
950720180 3:14877054-14877076 AAATGCCATAGCAATAGCATGGG + Intronic
950923833 3:16720729-16720751 AAGATCCACAGCTTCAGGATTGG + Intergenic
950975465 3:17238203-17238225 AACAGCAACAGCAGCAGCAGAGG - Exonic
951166777 3:19491599-19491621 CAAAGACATAGAATCAGCATAGG - Intronic
951433371 3:22634039-22634061 CAAACCCACAGCATAAGCCTGGG + Intergenic
953689526 3:45106295-45106317 GAAAGCCAGAGCCTCAGCAGGGG - Intronic
956796170 3:72720579-72720601 AAGAGCCAGAGAAACAGCATTGG - Intergenic
961628316 3:128278901-128278923 AGCTGCCACAGCAGCAGCATTGG - Intronic
964281872 3:155076648-155076670 TATAGGCACAGCAGCAGCATAGG + Intronic
966463154 3:180200296-180200318 AAAATCCTCAGAATCAGAATAGG - Intergenic
966495872 3:180579939-180579961 AAAAGCCAAAGCAACAAAATAGG + Intergenic
966769161 3:183488645-183488667 ATAACCCACACCATCAGCAGGGG - Exonic
966984691 3:185168402-185168424 TAAACCCACAGTATCAGCTTGGG + Intergenic
967594141 3:191310548-191310570 AATGGCCAGAGCATCAACATTGG - Intronic
967620807 3:191631101-191631123 AAGAGCCACAGCATCAGTAAGGG - Intergenic
968023398 3:195416355-195416377 AAAATCCTCAACATCACCATCGG + Intronic
968763801 4:2457785-2457807 ATCAGCCACAGCACCAGCCTCGG - Intronic
969353306 4:6610767-6610789 CATAGGCACAGCAGCAGCATGGG - Intronic
970664771 4:18324175-18324197 AAAAGACACACCATGAGCAAAGG - Intergenic
971034682 4:22680277-22680299 AAAAGCTACAGCATGGGCTTGGG + Intergenic
973859678 4:55050491-55050513 AAAAGCTAAAGCTACAGCATAGG - Intergenic
975411496 4:74056722-74056744 AAAAGACACATCATCAGCAAGGG + Intergenic
985864197 5:2500637-2500659 AAAGGCAGCAGCATCAGCATGGG - Intergenic
986228188 5:5836650-5836672 AGAAGTCACACCATCATCATGGG - Intergenic
986828038 5:11542828-11542850 AAAACCCACAGCAACAGGAAAGG + Intronic
986936747 5:12897876-12897898 AAGAGCCAAAGCAACAGCTTGGG - Intergenic
992191034 5:74292132-74292154 CAAAGCCACATGATCAACATAGG - Intergenic
994397988 5:99242653-99242675 AAAAGCCACAGCACCAGTTTGGG - Intergenic
995977761 5:118061879-118061901 AAAAGACACAGAATCAACTTAGG - Intergenic
997125462 5:131222596-131222618 AAAAGCAAGTGCAGCAGCATGGG - Intergenic
997427009 5:133810159-133810181 AAAAGCCAGAAGATCTGCATGGG - Intergenic
1000517433 5:162256416-162256438 AAAAGCTTCAGCAGCAGCTTCGG - Intergenic
1000566312 5:162851592-162851614 AACAACAACAGCAACAGCATAGG - Intergenic
1000816170 5:165924722-165924744 AAAGGAGACAACATCAGCATGGG + Intergenic
1001154212 5:169258996-169259018 AAAAGTCACAGCAACAACAATGG - Intronic
1001352520 5:170982788-170982810 GAAATTCACAGCATCAGGATTGG + Intronic
1001931964 5:175679496-175679518 CAAAGGCACAGAATCAGAATGGG + Intronic
1003491446 6:6626013-6626035 AAAGGCCATAGCATCAGGGTGGG + Intronic
1003584347 6:7373408-7373430 AAAGGCCACAGCTTCTGCTTTGG - Exonic
1004165823 6:13255775-13255797 AAAAGCCACAGAGGCAGCACTGG - Intronic
1004995495 6:21187731-21187753 AAAAGCAAAAGCAAAAGCATTGG - Intronic
1007622105 6:43221585-43221607 AGAGGCCACAGCATCAACAGCGG + Intronic
1007815240 6:44518609-44518631 AAAATCAACAGCATCAAAATTGG - Intergenic
1010234673 6:73565389-73565411 CACAGGCACAGCAGCAGCATGGG - Intergenic
1010751362 6:79619433-79619455 AATAGCAACAACAACAGCATAGG - Intergenic
1011021787 6:82821899-82821921 AAAAGCAAAAGCATGAGCCTAGG + Intergenic
1011292587 6:85792141-85792163 CATAGCCAGAGCAGCAGCATGGG + Intergenic
1011782179 6:90801804-90801826 AAAACAAACAGCATCAGCAAAGG + Intergenic
1012528759 6:100209295-100209317 AGAAGCAGCAGCAACAGCATAGG - Intergenic
1013255241 6:108378962-108378984 AAGAGCAGCAGCAGCAGCATAGG - Intronic
1013327672 6:109063651-109063673 AAAAGCAAAAGGATCAGCAAGGG - Intronic
1017644736 6:156528286-156528308 AAAACCAACAGAATCAACATTGG - Intergenic
1018228992 6:161657488-161657510 AAAAGCTAGAGCATCAGGAAAGG - Intronic
1021228976 7:18062528-18062550 AAAAGCCACAGACTTAGCAATGG - Intergenic
1022512476 7:30949066-30949088 AAGAATCACAGCACCAGCATAGG - Intronic
1022991050 7:35707541-35707563 AAAAGCCACAGAAGCATCATGGG + Intergenic
1023795348 7:43787761-43787783 GGAAGCCACAGCATCAGGATGGG - Intronic
1025192357 7:56905459-56905481 GAAAGCCACAGCATCAGCATTGG + Intergenic
1025679592 7:63671472-63671494 GAAAGCCACAGCATCAGCATTGG - Intergenic
1025686330 7:63721012-63721034 AAAAGCCAAAGCCCCAGCAATGG - Intergenic
1029669553 7:102019719-102019741 AAAAGCCACAGCATCAGCATTGG + Intronic
1030393780 7:108960397-108960419 GCAAGCCACAGAAACAGCATTGG + Intergenic
1030507293 7:110441152-110441174 AAAAACCACAACAGCAACATTGG + Intergenic
1032179938 7:129666465-129666487 AACAGCCACATTATCAACATGGG - Intronic
1035341939 7:158167807-158167829 CCATGCCCCAGCATCAGCATGGG - Intronic
1036413780 8:8527867-8527889 TAAAGCTACAGCATTAGCAGAGG + Intergenic
1036637409 8:10561104-10561126 AAAAGCAACAACATCAACATAGG - Intergenic
1042870012 8:73389932-73389954 AACAGCCACATCAGCAGCATGGG - Intergenic
1043124855 8:76379201-76379223 CAAAGCCACAGCATTATCTTGGG - Intergenic
1043153149 8:76744006-76744028 AAAAGCCACAGGAAGGGCATAGG - Intronic
1044161819 8:88927971-88927993 AAAAGGGACAGCATCTGCAAAGG + Intergenic
1044619813 8:94177692-94177714 AAAAGTCACAGCAGGAGGATTGG + Exonic
1045602704 8:103735620-103735642 AAGAGACACACCATCAGCAATGG - Intronic
1046733439 8:117750668-117750690 AGAAGCAGCAGCAGCAGCATTGG - Intergenic
1050965881 9:11802150-11802172 AAATTCCACAGCACCAGTATTGG - Intergenic
1051114071 9:13674099-13674121 GCAAGGCACAGCATCAGCACAGG - Intergenic
1052747466 9:32454420-32454442 AAATATCACAGCATCAGCACAGG + Exonic
1053161884 9:35818992-35819014 AACAGCCGCAGCAACAGCCTGGG + Exonic
1056112493 9:83409450-83409472 AAAAACCACTCCATCAGCACAGG + Intronic
1056817804 9:89814324-89814346 AAAAGCCTGATCCTCAGCATCGG - Intergenic
1057478089 9:95421671-95421693 GAAAGCCACAGTTACAGCATGGG + Intergenic
1057907887 9:98996315-98996337 AAAAGTCACAGCATCACCCCTGG - Intronic
1062172802 9:135144796-135144818 AAAAGAAACAGCATCAGCCTTGG - Intergenic
1062405485 9:136394337-136394359 AGAAGCCACAGCATCATCACTGG + Intronic
1187497736 X:19810415-19810437 TAAAGCCACAGATTCATCATTGG - Intronic
1188702958 X:33288047-33288069 AAAGGCCACATCATCATCAGTGG - Intronic
1191964216 X:66739325-66739347 AAAAGACACAGAATCACCCTAGG - Intergenic
1192171009 X:68854776-68854798 AAAACTCAAATCATCAGCATTGG + Intergenic
1192486802 X:71534123-71534145 CAACGCCAAAGCAGCAGCATCGG - Intronic
1194149954 X:90311318-90311340 TATAGCCAGAGCATGAGCATTGG + Intergenic
1194322861 X:92474032-92474054 AAACGCCACACTTTCAGCATTGG - Intronic
1194760533 X:97790976-97790998 AGAAACCACAGCATTATCATAGG - Intergenic
1195658444 X:107355635-107355657 CAAAGCCACATCAGAAGCATTGG + Intergenic
1195715305 X:107812494-107812516 AGAAGCCACAGCATAAACAAAGG + Intergenic
1195803207 X:108735302-108735324 CGCAGCTACAGCATCAGCATCGG - Exonic
1197464485 X:126785823-126785845 AATAGGCAGAGCAGCAGCATGGG + Intergenic
1198107894 X:133478337-133478359 AAACGTCACATCCTCAGCATTGG + Intergenic
1199260572 X:145769145-145769167 TAAAACCATGGCATCAGCATCGG + Intergenic
1200496382 Y:3888401-3888423 TATAGCCAGAGCATGAGCATTGG + Intergenic
1200626640 Y:5525301-5525323 ACAAGCAACAGCAGCAGCAGCGG + Intronic