ID: 1029669555

View in Genome Browser
Species Human (GRCh38)
Location 7:102019732-102019754
Sequence TCAGCATTGGAGACTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 179}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029669550_1029669555 19 Left 1029669550 7:102019690-102019712 CCGTGGTGGAGTTGTACCACGTA 0: 1
1: 0
2: 1
3: 16
4: 341
Right 1029669555 7:102019732-102019754 TCAGCATTGGAGACTCTGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1029669549_1029669555 20 Left 1029669549 7:102019689-102019711 CCCGTGGTGGAGTTGTACCACGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1029669555 7:102019732-102019754 TCAGCATTGGAGACTCTGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1029669546_1029669555 29 Left 1029669546 7:102019680-102019702 CCAGCCCTTCCCGTGGTGGAGTT 0: 1
1: 0
2: 3
3: 8
4: 126
Right 1029669555 7:102019732-102019754 TCAGCATTGGAGACTCTGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1029669552_1029669555 -4 Left 1029669552 7:102019713-102019735 CCACGCAAAAGCCACAGCATCAG 0: 1
1: 0
2: 2
3: 13
4: 160
Right 1029669555 7:102019732-102019754 TCAGCATTGGAGACTCTGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1029669547_1029669555 25 Left 1029669547 7:102019684-102019706 CCCTTCCCGTGGTGGAGTTGTAC 0: 1
1: 0
2: 0
3: 5
4: 39
Right 1029669555 7:102019732-102019754 TCAGCATTGGAGACTCTGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1029669548_1029669555 24 Left 1029669548 7:102019685-102019707 CCTTCCCGTGGTGGAGTTGTACC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 1029669555 7:102019732-102019754 TCAGCATTGGAGACTCTGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 179
1029669551_1029669555 3 Left 1029669551 7:102019706-102019728 CCACGTACCACGCAAAAGCCACA 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1029669555 7:102019732-102019754 TCAGCATTGGAGACTCTGCCAGG 0: 1
1: 0
2: 2
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029669555 Original CRISPR TCAGCATTGGAGACTCTGCC AGG Intronic
900587976 1:3442636-3442658 CCTGCCTTGGAGGCTCTGCCAGG - Intergenic
901630540 1:10646023-10646045 TGAGAAATGGAGCCTCTGCCAGG + Intronic
902927307 1:19704641-19704663 TTAGCAGGGCAGACTCTGCCAGG - Intronic
906074111 1:43039352-43039374 TCAGAATTGTCCACTCTGCCCGG + Intergenic
906341584 1:44985728-44985750 TGAGCATTTGACAGTCTGCCTGG - Intronic
906539678 1:46575720-46575742 TCAGCATTAGAGACTCTACTTGG - Intronic
907694610 1:56710375-56710397 TCAGCATTAAAGACTTTGACAGG + Exonic
910185128 1:84530644-84530666 TCAGGATTGGACAGTGTGCCAGG + Intergenic
912799748 1:112713597-112713619 CCAGCATTGATGACCCTGCCAGG + Exonic
914787859 1:150850674-150850696 CCAGGATTGCAGCCTCTGCCTGG + Intronic
918887476 1:190213979-190214001 TGAGAATTGGAGAATATGCCTGG - Intronic
921256212 1:213342041-213342063 GGAGCATGGGAGACACTGCCTGG - Intergenic
921487758 1:215734639-215734661 GCAGCATTCAAGACTTTGCCTGG - Intronic
921914662 1:220593907-220593929 TCAGCAGAGGAGAATGTGCCTGG - Intronic
922699007 1:227747313-227747335 ACATCACTGGAGACTTTGCCAGG - Intronic
922710171 1:227823103-227823125 TATGCATTGGAGACTCAGCAAGG - Intronic
923831989 1:237568296-237568318 TTTGCATTGGCGACTCTGTCTGG + Intronic
924823863 1:247519896-247519918 TTAGCATGGGAGAGTTTGCCAGG + Intronic
1065203605 10:23337559-23337581 TCATCATTGGTGACTATGGCTGG + Intronic
1067038150 10:42934035-42934057 TCAGCAGTGGGGTCTGTGCCAGG - Intergenic
1068116145 10:52739710-52739732 TCAGCATTTGCAACTCTGTCTGG - Intergenic
1076348150 10:129794866-129794888 TCAGCACTGGCCCCTCTGCCCGG - Intergenic
1076668825 10:132108006-132108028 CCAGCAGTGAGGACTCTGCCCGG - Intronic
1076931122 10:133532512-133532534 TCAGCAGTGCAAACTCTGCATGG - Intronic
1080244195 11:30161129-30161151 TCAGTCTTTGAGACTTTGCCTGG - Intergenic
1081773553 11:45663953-45663975 TCAGCAGTGGGGACACTTCCAGG - Intronic
1085013427 11:73157205-73157227 TCTGGATTGGACACTCTTCCAGG + Intergenic
1085306856 11:75491224-75491246 TCAGCACTTGAGACACTCCCAGG + Intronic
1085796301 11:79543103-79543125 TCTGCATTTGACACTCTCCCAGG - Intergenic
1090093740 11:123723835-123723857 TCAGCATATGAAACTCTGCAGGG + Intergenic
1090347199 11:126081069-126081091 TCAGCCCTGGTGCCTCTGCCAGG + Intergenic
1095419319 12:42008561-42008583 TGAGGATTGGAGACTGAGCCTGG + Intergenic
1095628457 12:44345219-44345241 TCAGCTCTGGTGACTTTGCCTGG - Intronic
1095639260 12:44468105-44468127 GCAGCAATGGGAACTCTGCCTGG - Intergenic
1098442930 12:70536987-70537009 TCAGAAATGCAGACTCGGCCGGG + Intronic
1098695462 12:73548237-73548259 TCAGCATTGGATATTCCTCCTGG - Intergenic
1100221034 12:92504804-92504826 TCAGCAGAGGAGACTCTCGCTGG - Intergenic
1100313034 12:93414903-93414925 TCAGCATTTGGAACACTGCCTGG + Intronic
1100433944 12:94554520-94554542 TCTGGATTGATGACTCTGCCGGG - Intergenic
1101403293 12:104406837-104406859 TCAGCAATTGGGACACTGCCTGG - Intergenic
1101526598 12:105536973-105536995 TCAGCCCTGGAGAGTCTTCCAGG + Intergenic
1101742889 12:107514690-107514712 TCCTCATTGGAGACTCTACATGG - Intronic
1102775960 12:115519310-115519332 TGAGCATTTGAGACTAAGCCGGG + Intergenic
1104772047 12:131369589-131369611 GCAGAATTGGACCCTCTGCCCGG + Intergenic
1104918154 12:132277104-132277126 TCAGCAGTGCAGTTTCTGCCGGG + Intronic
1104938437 12:132379918-132379940 TCAGCATTCCGGACTCTGCTCGG - Intergenic
1108582906 13:51841960-51841982 CCAGCATTTGAGACTGTACCTGG - Intergenic
1109829065 13:67761904-67761926 TCAGCAATGGAGCCTCTTCTTGG - Intergenic
1110148508 13:72222510-72222532 TCAGGTTTGGAGACTTTCCCTGG - Intergenic
1111930590 13:94509284-94509306 TCAGCTGTGGAGAGCCTGCCTGG + Intergenic
1114036377 14:18632902-18632924 TCAGCAGTGGAGACAGTCCCAGG - Intergenic
1114122258 14:19682131-19682153 TCAGCAGTGGAGACAGTCCCAGG + Intergenic
1118716390 14:68563091-68563113 TCTGCCTTGTTGACTCTGCCGGG + Intronic
1122329461 14:100902955-100902977 CCAGCAGAGGGGACTCTGCCAGG - Intergenic
1128713250 15:69887774-69887796 TCTGCATTGGAGAAGCTGCAAGG + Intergenic
1128720469 15:69943882-69943904 GGCACATTGGAGACTCTGCCAGG + Intergenic
1129949224 15:79571405-79571427 TGAGGATTGGAGACACTGCCTGG - Intergenic
1130649249 15:85752684-85752706 TCAGATTTGGAGCCTCTGCCAGG + Intergenic
1132306110 15:100813910-100813932 TTAGCAGTGGACACTCTGCAAGG + Intergenic
1132876969 16:2144284-2144306 TCAGGCTTCCAGACTCTGCCTGG - Intronic
1133728842 16:8560799-8560821 TCAGCATTGGGGACTGAGGCTGG + Intergenic
1135686652 16:24503221-24503243 CCAGCCTGGGAGACTCTGTCTGG - Intergenic
1135870997 16:26150327-26150349 TGAAGATTGAAGACTCTGCCTGG - Intergenic
1137983256 16:53087367-53087389 TCAGCAGTAGAGCATCTGCCAGG - Intronic
1139833846 16:69822500-69822522 GCATCATGGGAGACTTTGCCTGG + Intronic
1140303622 16:73782055-73782077 TGGGCAATGGAGACCCTGCCTGG - Intergenic
1141285756 16:82670068-82670090 TCAGAGTTTGAGATTCTGCCGGG + Intronic
1142285802 16:89171121-89171143 TCTGCATTGTAGTCCCTGCCGGG - Intergenic
1147588000 17:41663967-41663989 CCAGCATTGGAGGCTCTGTCTGG - Intergenic
1147597632 17:41727131-41727153 CCACCATAGGAGACTCTTCCTGG - Exonic
1147631141 17:41932463-41932485 TCAGCATTGGAGTCTGAGCCCGG - Intronic
1147710223 17:42458352-42458374 TCAGAATTCGAGACTCAGCCTGG + Intergenic
1149079812 17:52641738-52641760 TCAGCATCTGAAATTCTGCCTGG - Intergenic
1149269068 17:54956795-54956817 CCTGCTTTGGAGACTATGCCCGG - Intronic
1149856939 17:60090937-60090959 TCAGCCTTGGAGTCTCTTCATGG - Intergenic
1151034256 17:70779881-70779903 TCAGCATTGGTGACCGGGCCTGG - Intergenic
1151496939 17:74463544-74463566 TCAGCTCTGGAGTCTCTTCCTGG - Intergenic
1151750422 17:76034081-76034103 GCAGCATGGGAGGCACTGCCTGG + Intergenic
1151816678 17:76474609-76474631 TCATCAGGGGAGACTCTGCGGGG - Intronic
1152706165 17:81844712-81844734 GCAGCAGTGGTGACTCTGCCGGG - Intronic
1152844759 17:82592998-82593020 TCAGAATAAGAGCCTCTGCCCGG - Intronic
1152844795 17:82593199-82593221 TCAGAATAAGAGCCTCTGCCTGG - Intronic
1152844803 17:82593250-82593272 TCAGAATAAGAGCCTCTGCCTGG - Intronic
1152868605 17:82738444-82738466 TCAGCCTTGTTGACTCAGCCAGG - Intronic
1155400162 18:25429296-25429318 TGAGCACTGGAGACTTAGCCAGG - Intergenic
1156063804 18:33116136-33116158 TCAGCTTTGCAGACTCTCCTGGG - Intronic
1159270603 18:66144450-66144472 GCAGCATTGGAGATTCAGCTAGG - Intergenic
1160115832 18:76078585-76078607 TCAGCATGGAAGAGTTTGCCTGG + Intergenic
1160384824 18:78489299-78489321 TCAGTCTTGGTGACTCTTCCAGG - Intergenic
1161607142 19:5221403-5221425 TCAGAGTTGGGGACTCAGCCTGG - Intronic
1162026237 19:7895536-7895558 TCAGGATGGGAGGCTCTGCAGGG - Intronic
1162128753 19:8512876-8512898 TCACCATTGGAGCCACAGCCTGG + Intronic
1163046703 19:14648281-14648303 TAAGCATCGGTGATTCTGCCTGG + Intronic
1163370543 19:16898867-16898889 TCAGCATGGCCAACTCTGCCTGG + Intronic
1165138159 19:33683883-33683905 TCAGCATTCTAGACTCTGCCAGG + Intronic
1165293986 19:34911376-34911398 TCTGCATTGTAGATTCTGCTGGG - Intergenic
1166277323 19:41763019-41763041 TCAGCCATGGGGACTCTGCATGG + Intronic
927871508 2:26627227-26627249 TTAGAATAGGAGGCTCTGCCTGG + Intronic
933766294 2:85711729-85711751 TGAGCATTGGAGACTCTCCCAGG + Intergenic
935788249 2:106568414-106568436 GCAGCATTGGGGGGTCTGCCTGG - Intergenic
936743046 2:115538018-115538040 ACAGTGTTGCAGACTCTGCCTGG - Intronic
937117013 2:119414424-119414446 TCAGCATTATAGACTCGTCCTGG + Intergenic
938636882 2:133237739-133237761 TCAGCATTGAAGGCTCCTCCTGG + Intronic
941208971 2:162611195-162611217 TCAGCATTTGCTCCTCTGCCTGG - Intronic
945239719 2:207665312-207665334 TCAGGATTGGAGACTCTGATAGG - Intergenic
947719557 2:232362214-232362236 TCAGCATTGGAGGAGCTCCCTGG + Intergenic
948028489 2:234797748-234797770 ACAGCAATGGAGACTATGCATGG + Intergenic
1172445457 20:34990919-34990941 GCAGCAGTGGAGACCCTGCGAGG - Intronic
1172942421 20:38663674-38663696 TCAGCAGTGGGGATTCTGCTTGG + Intergenic
1173614072 20:44391254-44391276 TCAGCACTGGAGAACCTGCCAGG - Intronic
1174129647 20:48333950-48333972 TCAGCACTGGAGATTCAGCCAGG - Intergenic
1175554568 20:59839778-59839800 TCAGCAATGGAGAGTCAGCGAGG + Intronic
1176660948 21:9634377-9634399 TCTGCATGTGAGGCTCTGCCAGG + Intergenic
1180460503 22:15559962-15559984 TCAGCAGTGGAGACAGTCCCAGG - Intergenic
1181051925 22:20241967-20241989 TCACCCTTTGGGACTCTGCCTGG - Exonic
1181358664 22:22318466-22318488 TCTGCTTAGGGGACTCTGCCAGG - Intergenic
1181619303 22:24077635-24077657 GCAGCATTACAGACTCAGCCTGG - Intronic
1181713020 22:24703302-24703324 TCAGCCTTGTTGACTCAGCCAGG - Intergenic
1181911183 22:26239573-26239595 TCAGCCTTGGAGCCTCTGGGAGG + Intronic
1183499426 22:38169499-38169521 TGGGCATGGGAGACTGTGCCTGG - Intronic
1184147667 22:42620741-42620763 TCAGCACAGTAGACTCTTCCTGG - Intronic
1184295966 22:43525802-43525824 TCAGCATTGGAGGCCCGACCTGG - Intergenic
949931486 3:9082029-9082051 TCAGCATTGGAGGCAGAGCCTGG + Intronic
950525319 3:13519602-13519624 TGAGCATTGGAGAGACTGCTGGG + Intergenic
953360398 3:42290706-42290728 TCAGCCCTGGAGCCTCTCCCCGG + Intergenic
953960757 3:47264038-47264060 TCAGCATGGGAGACTGTGTGAGG - Intronic
954865062 3:53721736-53721758 TCAGCTTTGACAACTCTGCCAGG + Intronic
955000217 3:54920626-54920648 TGACCATAGGAGCCTCTGCCAGG + Intronic
956871211 3:73420160-73420182 TCTGTCTTGGAGACTATGCCTGG + Intronic
962746241 3:138399075-138399097 TCTGCTTTGGAGCCTCTTCCAGG - Intronic
963015402 3:140819888-140819910 TGAGGAATGGAGACTCTGCCAGG + Intergenic
969224155 4:5783719-5783741 GCAGCAGTGGAAACTCTTCCAGG + Exonic
970593436 4:17578404-17578426 TTGGCATTGGTAACTCTGCCAGG - Intronic
972969732 4:44558679-44558701 TCAGCCTGGCAGTCTCTGCCTGG - Intergenic
975647657 4:76561474-76561496 TCAGCCCTTGAGTCTCTGCCTGG + Intronic
976388096 4:84482969-84482991 TCAGCGTTGGAGAGCCTGCCCGG + Intergenic
977364944 4:96056221-96056243 TGAACATTGGAGACTATGGCTGG + Intergenic
979430365 4:120622252-120622274 TCATCATTGGAAACTAGGCCAGG - Intergenic
980007518 4:127559100-127559122 TCAAAATTGGAGAGTGTGCCAGG - Intergenic
980283553 4:130753607-130753629 TCCTAAATGGAGACTCTGCCAGG - Intergenic
980807457 4:137831825-137831847 GCAGCCTGGCAGACTCTGCCAGG - Intergenic
982074435 4:151724502-151724524 AGAGCATTGAAGCCTCTGCCAGG - Intronic
985414448 4:189722161-189722183 TCTGCATGTGAGGCTCTGCCAGG - Intergenic
985689585 5:1299680-1299702 TCTGCCCTGGAGACTCAGCCTGG - Intergenic
986801646 5:11266802-11266824 TCAGAAGTGGAAACTCTTCCAGG + Intronic
987574864 5:19712136-19712158 TAAGTATTGGAGACTCTGAAGGG + Intronic
989731235 5:44652239-44652261 ACAGAATTGGAGATGCTGCCAGG + Intergenic
990598384 5:57333321-57333343 TCAGCACTGGAAATTCTCCCTGG - Intergenic
993828931 5:92729225-92729247 TCTGCACTGGAGAATCTGCTAGG - Intergenic
995738177 5:115325776-115325798 TCAGTCTTTGATACTCTGCCAGG + Intergenic
997409018 5:133675916-133675938 TCAGCCTAGGAGAGTCTGACAGG + Intergenic
1002929564 6:1624108-1624130 TCTGCACCGGAGACTCTGCGGGG + Exonic
1007407327 6:41642535-41642557 TCTGCAGAGGAGACACTGCCCGG - Intronic
1008833019 6:55792236-55792258 TCAAGATTTGAGACCCTGCCGGG + Intronic
1015671157 6:135691458-135691480 TAAACATTGGAGACTCTGAAAGG + Intergenic
1015855418 6:137618961-137618983 TCAGCATTCGAGAAGCAGCCTGG + Intergenic
1019560685 7:1655088-1655110 AAAGCATCGGTGACTCTGCCAGG + Intergenic
1020596976 7:10219221-10219243 TCAGTATTTCAGACTATGCCTGG + Intergenic
1024521999 7:50313799-50313821 TCTACATTGGACACTATGCCAGG + Intronic
1024598833 7:50962264-50962286 TCAAGATTGGAATCTCTGCCAGG - Intergenic
1029669555 7:102019732-102019754 TCAGCATTGGAGACTCTGCCAGG + Intronic
1029748896 7:102532091-102532113 ACAGAACTGGAGGCTCTGCCGGG - Intergenic
1029766839 7:102631197-102631219 ACAGAACTGGAGGCTCTGCCGGG - Intronic
1033047914 7:137979317-137979339 TCAGGATGGCAGGCTCTGCCAGG + Intronic
1034392102 7:150794698-150794720 GCTGCAATGCAGACTCTGCCAGG - Intronic
1035288383 7:157821007-157821029 CCAGCATGGGAGACTCCACCAGG - Intronic
1035864696 8:3069764-3069786 GCCCCATTGGAGACTCTGCATGG + Intronic
1038516381 8:28191010-28191032 TCTACTTTGGAGACTCTGCCTGG + Exonic
1038874801 8:31536689-31536711 TCAGGAAGGGAGACCCTGCCAGG + Intergenic
1040564392 8:48552968-48552990 TCAGCCTTGCCCACTCTGCCTGG - Intergenic
1042005050 8:64170209-64170231 TCAGCATGGCAGACTGTGCTTGG - Intergenic
1043576908 8:81668871-81668893 CCAGCATTGGAGAGTATCCCAGG - Intronic
1046375314 8:113372084-113372106 TCAGGATTTGTGACTCTGCAAGG + Intronic
1047596282 8:126380865-126380887 TCAGCCATGGAAAGTCTGCCAGG - Intergenic
1053281859 9:36825723-36825745 AGAGCCCTGGAGACTCTGCCTGG + Intergenic
1056202514 9:84290261-84290283 CCAGCAGTGGAGACTCCGTCTGG + Exonic
1056853288 9:90102856-90102878 TGAGCATCCCAGACTCTGCCTGG + Intergenic
1056889477 9:90477626-90477648 TGAGCATTGGAGAGGCTGCATGG + Intergenic
1057193226 9:93098779-93098801 GCAGCAGCGGAGGCTCTGCCTGG + Intronic
1057733441 9:97632059-97632081 TCAGCATTCAGAACTCTGCCTGG + Intronic
1060116759 9:120947660-120947682 TTAGCATTGGTGACTTTGACAGG - Intergenic
1062451800 9:136618882-136618904 TGGGCAGTGGAGACTCAGCCTGG + Intergenic
1203638518 Un_KI270750v1:136221-136243 TCTGCATGTGAGGCTCTGCCAGG + Intergenic
1185964786 X:4588247-4588269 TCAGCCTTGGAGATTCTCTCTGG + Intergenic
1189752465 X:44236472-44236494 TCAGTATAGGAGACCCTGCAAGG - Intronic
1190139720 X:47832222-47832244 TCAGCTTTGGGGACTCGGACTGG - Intergenic
1190948279 X:55117295-55117317 TCAGCATGGAGGACTATGCCAGG - Intronic
1191058522 X:56269455-56269477 TCAGCCTTGCAGAGTCTGCAGGG + Exonic
1195489604 X:105452077-105452099 TCAACACTGGAGATTTTGCCAGG - Intronic
1195757615 X:108214645-108214667 TCAGTATTGGAAGCTCTGCATGG + Intronic
1197173064 X:123455933-123455955 TCTGTATTGGAGACTCTTCAAGG + Intronic
1199044747 X:143155719-143155741 TCAGCAGTGGTGTCTCTGCTGGG + Intergenic
1199507063 X:148574997-148575019 TGAGCACTGGACACTGTGCCTGG + Intronic
1200055946 X:153461003-153461025 TCAGCCTGGGAGACTTTGCTGGG - Intronic
1201474265 Y:14363883-14363905 TGTGCATTGGGGACTATGCCTGG - Intergenic