ID: 1029672778

View in Genome Browser
Species Human (GRCh38)
Location 7:102045427-102045449
Sequence GAGGGGGCGCGCGGGCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 622}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029672778_1029672783 -10 Left 1029672778 7:102045427-102045449 CCACTGCGCCCGCGCGCCCCCTC 0: 1
1: 0
2: 4
3: 87
4: 622
Right 1029672783 7:102045440-102045462 GCGCCCCCTCCGATGTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029672778 Original CRISPR GAGGGGGCGCGCGGGCGCAG TGG (reversed) Intronic