ID: 1029672778 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:102045427-102045449 |
| Sequence | GAGGGGGCGCGCGGGCGCAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 714 | |||
| Summary | {0: 1, 1: 0, 2: 4, 3: 87, 4: 622} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1029672778_1029672783 | -10 | Left | 1029672778 | 7:102045427-102045449 | CCACTGCGCCCGCGCGCCCCCTC | 0: 1 1: 0 2: 4 3: 87 4: 622 |
||
| Right | 1029672783 | 7:102045440-102045462 | GCGCCCCCTCCGATGTGGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1029672778 | Original CRISPR | GAGGGGGCGCGCGGGCGCAG TGG (reversed) | Intronic | ||