ID: 1029675254

View in Genome Browser
Species Human (GRCh38)
Location 7:102064294-102064316
Sequence GCACTTTGGGAGGCCAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 733858
Summary {0: 28733, 1: 128252, 2: 230554, 3: 215949, 4: 130370}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675254_1029675263 1 Left 1029675254 7:102064294-102064316 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1029675263 7:102064318-102064340 GGGATTACAGGCATGAGCAACGG 0: 14
1: 1919
2: 4906
3: 5219
4: 3580
1029675254_1029675264 7 Left 1029675254 7:102064294-102064316 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675254_1029675266 25 Left 1029675254 7:102064294-102064316 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29
1029675254_1029675265 17 Left 1029675254 7:102064294-102064316 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1029675265 7:102064334-102064356 GCAACGGTGCCGGCTCTAAATGG No data
1029675254_1029675268 26 Left 1029675254 7:102064294-102064316 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675254 Original CRISPR GCACTTTGGGAGGCCAAGGT GGG (reversed) Intronic
Too many off-targets to display for this crispr