ID: 1029675255

View in Genome Browser
Species Human (GRCh38)
Location 7:102064295-102064317
Sequence AGCACTTTGGGAGGCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511305
Summary {0: 55360, 1: 145174, 2: 158991, 3: 100124, 4: 51656}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675255_1029675266 24 Left 1029675255 7:102064295-102064317 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29
1029675255_1029675264 6 Left 1029675255 7:102064295-102064317 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675255_1029675268 25 Left 1029675255 7:102064295-102064317 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73
1029675255_1029675263 0 Left 1029675255 7:102064295-102064317 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1029675263 7:102064318-102064340 GGGATTACAGGCATGAGCAACGG 0: 14
1: 1919
2: 4906
3: 5219
4: 3580
1029675255_1029675265 16 Left 1029675255 7:102064295-102064317 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1029675265 7:102064334-102064356 GCAACGGTGCCGGCTCTAAATGG No data
1029675255_1029675269 30 Left 1029675255 7:102064295-102064317 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1029675269 7:102064348-102064370 TCTAAATGGTTTTAAGGGCACGG 0: 1
1: 2
2: 1
3: 11
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675255 Original CRISPR AGCACTTTGGGAGGCCAAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr