ID: 1029675257

View in Genome Browser
Species Human (GRCh38)
Location 7:102064298-102064320
Sequence CCCAGCACTTTGGGAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 763604
Summary {0: 79234, 1: 201556, 2: 232767, 3: 156913, 4: 93134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675257_1029675266 21 Left 1029675257 7:102064298-102064320 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29
1029675257_1029675263 -3 Left 1029675257 7:102064298-102064320 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1029675263 7:102064318-102064340 GGGATTACAGGCATGAGCAACGG 0: 14
1: 1919
2: 4906
3: 5219
4: 3580
1029675257_1029675265 13 Left 1029675257 7:102064298-102064320 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1029675265 7:102064334-102064356 GCAACGGTGCCGGCTCTAAATGG No data
1029675257_1029675268 22 Left 1029675257 7:102064298-102064320 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73
1029675257_1029675269 27 Left 1029675257 7:102064298-102064320 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1029675269 7:102064348-102064370 TCTAAATGGTTTTAAGGGCACGG 0: 1
1: 2
2: 1
3: 11
4: 187
1029675257_1029675264 3 Left 1029675257 7:102064298-102064320 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675257 Original CRISPR CCCAGCACTTTGGGAGGCCA AGG (reversed) Intronic
Too many off-targets to display for this crispr