ID: 1029675259

View in Genome Browser
Species Human (GRCh38)
Location 7:102064304-102064326
Sequence TGTAATCCCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1035426
Summary {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1029675259_1029675269 21 Left 1029675259 7:102064304-102064326 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1029675269 7:102064348-102064370 TCTAAATGGTTTTAAGGGCACGG 0: 1
1: 2
2: 1
3: 11
4: 187
1029675259_1029675268 16 Left 1029675259 7:102064304-102064326 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG 0: 1
1: 2
2: 0
3: 6
4: 73
1029675259_1029675265 7 Left 1029675259 7:102064304-102064326 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1029675265 7:102064334-102064356 GCAACGGTGCCGGCTCTAAATGG No data
1029675259_1029675264 -3 Left 1029675259 7:102064304-102064326 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1029675264 7:102064324-102064346 ACAGGCATGAGCAACGGTGCCGG No data
1029675259_1029675263 -9 Left 1029675259 7:102064304-102064326 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1029675263 7:102064318-102064340 GGGATTACAGGCATGAGCAACGG 0: 14
1: 1919
2: 4906
3: 5219
4: 3580
1029675259_1029675266 15 Left 1029675259 7:102064304-102064326 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1029675266 7:102064342-102064364 GCCGGCTCTAAATGGTTTTAAGG 0: 1
1: 0
2: 2
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1029675259 Original CRISPR TGTAATCCCAGCACTTTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr